JKAOH Journal of Korean Academy of Oral Health J Korean Acad Oral Health 1225-388X 2093-7784 Journal of Korean Academy of Oral Health 10.11149/jkaoh.2018.42.1.9 jkaoh-42-9 Original Article Inhibitory effect of 18β-glycyrrhetinic acid on the biofilm formation of Streptococcus mutans YuJungheon JeonJeonghoon LeeSanghwa LG Household & Health Care Ltd., Daejeon, Korea Corresponding Author: Sanghwa Lee LG Household & Health Care Ltd., 84, Jang-dong, Yuseong-gu, Daejeon 34114, Korea Tel: +82-42-860-8723 Fax: +82-42-862-2476 E-mail: shleek@lgcare.com 032018 15032018 421 915 11012018 22022018 15032018 Copyright © 2018 by Journal of Korean Academy of Oral Health 2018 This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Objectives

The present study aimed at investigating the potential of using 18β-glycyrrhetinic acid against the cariogenic characteristics of Streptococcus mutans UA159.

 Methods

The effects of 18β-glycyrrhetinic acid on biofilm formation and acid production were evaluated; the latter are indicators of cariogenicity of S. mutans. Biofilm architecture was also analyzed by scanning electron microscopy (SEM), and changes in gene expression related to biofilm formation were studied by quantitative RT-PCR.

 Results

Treatment with 18β-glycyrrhetinic acid at a concentration of 20 μg/ml inhibited biofilm formation by 95% in the absence of sucrose and 60% in its presence, reduced acid production by 88.8%, and significantly suppressed the gene expression of comDE, gbpB, gtfC and vicR, which are thought to be involved in the virulence of S. mutans.

 Conclusions

These results suggest that 18β-glycyrrhetinic acid could be used as a complementary or alternative agent for preventing dental caries by interfering with the virulence properties of S. mutans without affecting the viability of the bacterial population.

 18β-glycyrrhetinic acid Biofilm inhibition S. mutans Dental caries References ChauNPPanditSJungJEJeonJGEvaluation of Streptococcus mutans adhesion to fluoride varnishes and subsequent change in biofilm accumulation and acidogenicityJ Dent2014426726734 MitchellTJThe pathogenesis of streptococcal infections: from tooth decay to meningitisNat Rev Microbiol200313219230 PecharkiDPetersenFCAssevSScheieAAInvolvement of antigen I/P surface proteins in Strpetococcus mutans and Streptococcus intermedius biofilm formationOral Microbiol Immunol2005206366371 BowenWHKooHBiology of Streptococcus mutans-derived glucosyltransferases: role in extracellular matrix formation of cariogenic biofilmsCaries Res20114516986 ZhiyanHQianWYuejianHJingpingLYuntao J,RuiMUse of the quorum sensing inhibitor furanone C-30 to interfere with biofilm formation by Streptococcus mutans and its luxS mutant strainInt J Antimicrob Agents2012403035 De SousaDLLimaRAZaninICKleinMIJanalMNDuarteSEffect of twice-daily blue light treatment on matrix-rich biofilm developmentPLoS One2015107e0131941DOI:10.1371/journal. pone.0131941 PMID: 26230333 Matesanz-PerezPGarcia-GargalloMFigueroEBascones-MartinzASanzMHerreraDA systematic review on the effects of local antimicrobials as adjuncts to subgingival debridement, compared with subgingival debridement alone, in the treatment of chronic periodontitisJ Clin Perodontol201340227241 Asl MN,HosseinzadehHReview of pharmacological effects of Glycyrrhiza sp. and its bioactive compoundsPhytother Res200822709724 GeethaRVRoyAIn-vitro evaluation of anti bacterial activity of ethanolic root extract of Glycyrrhiza glabra on oral microbesIJDDR201244161165 FioreCEisenhutMRagazziEZanchinGArmaniniDA history of the therapeutic use of liquorice in EuropeJ Ethnopharmacol200599317324 TsukiyamaRIKatsuraHTokurikiNKobayashiMAnti-bacterial activity of licochalicone A against spore-forming bacteriaAntimi-crob Agents and Chemother20024612261230 HamidRRotshteynYRabadiLParikhRBullockPComparision of alamar blue and MTT assays for high through-put screeningToxicol In Vitro200418703710 PettitRKWeberCAKeanNJHoffmannHPettitGRTanRMicroplate alamar blue assay for Staphylococcus epidermidis biofilm susceptibility testingAntimicrob Agents Chemother20054926122617 CiardiJERosenthalABBowenWHRapid quantitative determination of the effect of antiplaque agents and antisera on the growth, acid production and adherence of Streptococcus mutansJ Dent Res198160756762 HasanSDanishuddinMAdilMSinghKVermaPKKhanAUEfficacy of E. officinalis on the cariogenic properites of Streptococcus mutans: a novel and alternative approach to suppress Quorum-sensing mechanismPLoS One201277e40319DOI:10.1371/ Journal.pone.0040319 MarshPDPlaque as a biofilm: pharmacological principles of drug delivery and action in the sub- and supragingival environmentOral Dis200391622 BanasJAVirulence properties of Streptococcus mutansFront Biosci2004912671277 IslamBKhanSNNaeemASharmaVKhanAUNovel effect of plant lectins on the inhibition of Streptococcus mutans biofilm formation on saliva-coated surfaceJ Appl Microbiol200910616821689 MatsumotoMMinamiTSasakiHSobueSHamadaSOoshimaTInhibitory effects of oolong tea extract on caries inducing properties of mutans streptococciCaries Res199933441445 AjdićDMcShanWMMcLaughlinRESavićGChangJCarsonMBGenome sequence of Streptococcus mutans UA159, a cariogenic dental pathogenProc Natl Acad Sci USA2002991443414439 OatmenTRPreventive dentistry techniques in the treatment of dental caries and biofilm control: A ReviewHonors Proj-ects201188 MatsumiYFujitaKTakashima Y,YanagidaKMorikawaYMatsumotoMControbution of glucan-binding protein A to firm and stable biofilm formation by Streptococcus mutansMol Oral Micro-biol201530217226 KimDHwangGLiuYWangYSinghAPVorsaNCran-berry flavonoids modulate cariogenic properties of mixed-species biofilm through exopolysaccharides-matrix disruptionPLoS One20151012e0145844DOI:10.1371/journal.pone.0145844 PMID: 26713438 KuramitsuHKVirulence properties of oral bacterial: impact of molecular biologyCurr Issues Mol Biol200133536 SenadheeraDGuggenheimBSpataforaGAHuangYCChoiJHungDCA VicRK signal transduction system in Streptococcus mutans affects gtfBCD, gbpB, and fif expression, biofilm formation, and genetic competence developmentJ Bacteriol200518740644076 Figures and Tables

Effect of 18b-glycyrrhetinic acid on growth of S. mutans. S. mutans incubated with present and absent of 20 μg/ml 18β-glycyrrhetinic acid in a 96well plate at 37°C.

Inhibitory effect of 18β-glycyrrhetinic acid on the biofilm formation by S. mutans in the absence (sucrose-independent) and presence of 1% sucrose (sucrose-dependent). *Significant inhibition compared with untreated control (P<0.05).

SEM images of S. mutans biofilm formed in the presence and absence of the 18β-glycyrrhetinic acid after at 37°C overnight incubation. (A) control, (B) 18β-glycyrrhetinic acid.

Effect of 18β-glycyrrhetinic acid on the biofilm related genes expression of S. mutans. *Significant inhibition compared with untreated control (P<0.05).

Nucleotide sequences of primers used in this study

Gene† Description Primer sequence (5’→3’)15)
Forward Reverse
comDE Competence-stimulating peptide ACAATTCCTTGAGTTCCATCCAAG TGGTCTGCTGCCTGTTGC
gbpB Glucan-binding proteins (GBPs) ATGGCGGTTATGGACACGTT TTTGGCCACCTTGAACACCT
gtfC Glucan production CTCAACCAACCGCCACTGTT GGTTTAACGTCAAAATTAGCTGTATTAGC
vicR Two-component regulatory system CGTCTAGTTCTGGTAACATTAAGTCCAATA TGACACGATTACAGCCTTTGATG
16S rRNA Normalizing internal standard CTTACCAGGTCTTGACATCCCG ACCCAACATCTCACGACACGAG

Based on the National Center for Biotechnology Information (NCBI) S. mutans genome database.

Effect of 18b-glycyrrhetinic acid on the acid production of S mutans

Concentration of Glycyrrhetinic acid (mg/ml) pH (mean±SD)
0 hr After overnight
0 7.1±0.15 5.3±0.07
5 7.1±0.00 5.4±0.07
10 7.1±0.07 5.6±0.00
20 7.1±0.07 6.2±0.07*

*Significant different compared with untreated control (P<0.05).