Forkhead box P3 (Foxp3) is the most reliable marker for regulatory T cells, which play an important role in maintaining renal allograft tolerance. Recently, Foxp3 polymorphisms have been reported to be associated with graft outcome in kidney transplantation. We analyzed the association of Foxp3 polymorphisms with renal allograft outcome.
Methods
Foxp3 polymorphisms (rs3761548 A/C, rs2280883 C/T, rs5902434 del/ATT, and rs2232365 A/G) were tested by PCR with sequence-specific primers (PCR-SSP) in 231 adult kidney transplantation recipients from 1996-2004 at Seoul National University Hospital.
Results
Patients with the rs3761548 CC genotype showed better graft survival than those with the AC or AA genotype (log rank test, P=0.03). Patients with the rs3761548 CC genotype also showed a lower rate of recurrence of the original glomerular disease than those with the AC or AA genotype (P=0.01). The frequency of acute rejection (AR) in patients with the rs2280883 TT genotype was lower than that in patients with the rs2280883 CT or CC genotype (26.9% vs 53.3%, P=0.038). Patients with the rs2280883 TT genotype also showed better graft survival than those with the CT or CC genotype (P=0.03).
Conclusions
Foxp3 rs3761548 CC and rs2280883 TT genotypes were associated with superior graft outcome of kidney transplantation. Further studies involving a larger number of patients are needed.
Foxp3Single nucleotide polymorphismKidney transplantationGraft outcomeSeoul National University Hospitalhttp://dx.doi.org/10.13039/5011000043322014-1187INTRODUCTION
Improved pre-transplantation evaluation and the development of post-transplantation immunosuppressive therapy have led to a marked improvement in short-term graft survival in kidney transplantation. However, long-term graft survival remains unsatisfactory [1]. Immunologic responses of patients play pivotal roles in graft rejection or recurrence of underlying renal disease. Regulatory T cells (Tregs) promote a state of antigen-specific peripheral tolerance by suppressing activation and expansion of T effector cells, as reported in experimental models [23]; therefore, they play an important role in maintaining self-tolerance and in regulating graft rejection and graft-versus-host disease [45].
Forkhead box P3 (Foxp3) is a transcription factor that regulates Treg development and function and remains the most reliable marker for Treg [6]. Therefore, Foxp3 polymorphisms, which could affect the function and quantity of the Foxp3 molecule and thus result in Treg function defects, have been associated with various autoimmune diseases [78].
For kidney transplantation, the impact of Foxp3+ Tregs on graft outcomes seems conflicting in previous reports [9101112131415]. In some study, the presence of intragraft Tregs have been associated with favorable renal allograft outcome [910]. The FoxP3+ Treg/CD3+ T cell ratio positively correlated with graft function at two years after transplantation [9]. These cells could direct a FoxP3-induced immune response toward suppression of T effector cells, promoting renal graft acceptance with improved function. Lower level of intragraft Foxp3 mRNA predicts progression in renal transplants with borderline change [11]. The mRNA levels of Foxp3 in peripheral blood were higher in patients with operational tolerance or stable kidney graft function compared with patients with chronic rejection [1213]. However, other groups reported that mRNA for Foxp3 in the urine of recipients with acute rejection (AR) was higher than recipients with normal biopsy [14] and association of higher density of FoxP3+ cells with worse graft outcome in recipients with acute cellular rejection [15].
Recently, an association between Foxp3 polymorphisms and graft outcome has been reported also with conflicting results [161718]. Therefore, we analyzed the association of four Foxp3 single nucleotide polymorphisms (SNPs) (rs3761548 A/C, rs2280883 C/T, rs5902434 del/ATT, and rs2232365 A/G) with graft outcome in kidney transplantation.
METHODS1. Subjects
This study included 231 kidney transplantation cases performed between January 1996 and December 2004 at the Seoul National University Hospital, Seoul, Korea. The baseline characteristics of the 231 kidney transplant recipients are shown in Table 1. Residual DNA samples were collected after routine preoperative tests for HLA genotype. DNA samples from 195 healthy Korean individuals studied in our previous cohort were used as the normal controls [19]. Samples were preserved at –70℃ prior to the experiments performed for this study. The following recipient characteristics were collected retrospectively: age and gender of recipient; age and gender of donor; type of donor (living vs cadaveric donor); primary renal disease causing end-stage renal disease; number of HLA mismatches; number of HLA-DR mismatches; crossmatch result at the time of transplantation; duration of hemodialysis; type of immunosuppression; time of transplantation; occurrence and time point of biopsy-proven AR; recurrence and time point of primary renal disease; 1-, 3-, 5-, and 10-yr creatinine levels post-transplantation; and occurrence and time point of graft failure, defined as graft nephrectomy or return to hemodialysis. The study protocol was designed in accordance with the Declaration of Helsinki and approved by the institutional review board of Seoul National University Hospital (IRB No. 1306-121-501).
2. Analysis of <italic>Foxp3</italic> Gene SNPs
DNA was extracted from the peripheral blood of 231 patients who had kidney transplantation between January 1996 and December 2004 by using the LaboPass Genomic DNA Extraction Kit (COSMO, Seoul, Korea) or QuickGene DNA whole blood kit (Fujifilm, Tokyo, Japan) when HLA genotyping for pre-operation evaluation was performed. For 195 healthy controls, DNA was extracted using LaboPass Genomic DNA Extraction Kit (COSMO, Seoul, Korea) during the period of January 1999 and July 2001. All DNA samples were preserved at –70℃ prior to being used for Foxp3 polymorphisms analyses which were performed during the period of June 2015 and July 2016. Four Foxp3 polymorphisms (rs3761548 A/C, rs2280883 C/T, rs5902434 del/ATT, and rs2232365 A/G) were analyzed by PCR with sequence-specific primers (PCR-SSP) with some modifications [20] (Table 2). PCR was performed by using a 40-µL reaction mixture containing 40 ng DNA, 0.2mM of each primer, 0.8 µL of 10mM dNTP, 2.0mM MgCl2, 1.0 U Taq DNA polymerase (Roche Applied Science, Basel, Switzerland), and 4 µL of 10× reaction buffer. The PCR protocol consisted of an initial denaturation step at 95℃ for 5 min; 35 cycles of denaturation at 95℃ for 30 sec, annealing (temperatures detailed in Table 2) for 30 sec, and extension at 72℃ for 30 sec; and a final extension step at 72℃ for 5 min.
3. Statistical analysis
Differences of allele frequency and genotype frequency were compared by using a 2-sided Chi-square test or Fisher's exact test, as appropriate. The odds ratio (OR) was calculated by using a 95% confidence interval (CI). Potential associations of variables with graft survival were analyzed by using the Cox proportional hazards regression model. Death-censored graft survival was analyzed by using the Kaplan-Meier method and the log rank test. A P value of <0.05 was considered statistically significant. SPSS for Windows version 18.0 (SPSS, Chicago, IL, USA) was used for statistical analysis.
RESULTS
The frequencies of four Foxp3 SNPs in kidney transplant recipients were not statistically different from those of the normal controls (data not shown). Univariate Cox regression analysis indicated that the Foxp3 rs3761548 AC or AA genotype, rs2280883 CT or CC genotype, and AR episode were associated with graft survival (P=0.038, P=0.032, and P<0.001, respectively; Table 2).
The 1-, 3-, 5-, and 10-yr creatinine levels post-transplantation did not differ according to the Foxp3 genotypes (data not shown). However, AR frequency was lower in patients with the rs2280883 TT genotype than in patients with the CT or CC genotype (26.9% vs 53.3%, P=0.035, OR=0.3, 95% CI 0.1–0.9; Table 3). Kaplan-Meier survival analysis indicated that patients with the rs3761548 CC genotype (n=209) showed better graft survival than those with the AC or AA genotype (n=22) (log rank test, P=0.03; Fig. 1A). Patients with the rs2280883 TT genotype (n=216) showed better graft survival than those with the CT or CC genotype (n=15) (P=0.02; Fig. 1B). Patients with the rs3761548 CC genotype (n=209) showed a lower rate of recurrence of the original glomerular disease than those with the AC or AA genotype (n=22) (P=0.01; Fig. 2).
DISCUSSION
In our study, both the rs3761548 AC and AA genotypes were associated with inferior graft survival and recurrence of primary renal disorders. The Foxp3 rs3761548 AA genotype has been associated with psoriasis [21], unexplained recurrent spontaneous abortion in Chinese individuals [22], and intractability of Graves' disease in Japanese individuals [23]. Recently, an association between the AA genotype and allograft rejection has been reported in kidney transplantation in Chinese individuals [16]. In addition, an association between the rs3761548 A allele and AR and between the rs3761548 AA genotype and lower graft survival have been reported in Indian individuals [18], which is similar to our findings. Polymorphisms in the promoter of the Foxp3 may alter the binding specificity of transcription factors, thus influencing transcription initiation, and therefore, might affect the function or quantity of Treg [24]. Oda et al [7] suggested that the rs3761548 AA genotype leads to a loss of binding with E47 and c-Myb, resulting in defective transcription of Foxp3. Qiu et al [16] demonstrated that patients with the AA genotype are more prone to allograft rejection in kidney transplantation and that Treg function is weaker in patients with the AA genotype than in those with the CC genotype.
The association of Foxp3 SNPs with recurrence of primary renal disorder has yet to be studied. The association of the Th1 response (high production of tumor necrosis factor-α and low production of interleukin-10) with a lower recurrence of IgA nephropathy following kidney transplantation has been reported [25]. The Treg response defect due to Foxp3 SNPs may affect the recurrence of primary glomerular disease. Further studies are needed to elucidate the association between various T cell responses and the recurrence of primary glomerular disease.
In our study, both the rs2280883 CT and CC genotypes were associated with inferior graft survival. The incidence of the Foxp3 rs2280883 CC genotype has been shown to be increased in infertile women without endometriosis in Brazil [26] and Graves's disease in China [27]; however, it was not associated with Graves' disease and juvenile idiopathic arthritis in the United Kingdom [28, 29] or with psoriasis in China [21]. To date, no study has analyzed the association of rs2280883 polymorphisms with allograft outcome following kidney transplantation, although polymorphisms of other genes relevant to host immune responses, such as FasL or IL-17, have been reported [30, 31]. Further studies involving a larger number of patients and other ethnic groups are needed to confirm the association of the rs2280883 CC genotype with renal allograft outcome.
In conclusion, our study revealed the association between the rs3761548 CC and rs2280883 TT genotypes and superior graft survival in kidney transplantation. These findings may help elucidate the role of Treg in kidney transplantation and predict renal allograft outcome.
Acknowledgments
This study was supported by grant number 0420140450 (2014-1187) from the SNUH research fund.
Authors' Disclosures of Potential Conflicts of Interest: No potential conflicts of interest relevant to this article were reported.
YatesPJNicholsonMLThe aetiology and pathogenesis of chronic allograft nephropathyTranspl Immunol20061614815717138047ZhengXXSánchez-FueyoAShoMDomenigCSayeghMHStromTBFavorably tipping the balance between cytopathic and regulatory T cells to create transplantation toleranceImmunity20031950351414563315LiXCTurkaLAAn update on regulatory T cells in transplant tolerance and rejectionNat Rev Nephrol2010657758320683480GracaLCobboldSPWaldmannHIdentification of regulatory T cells in tolerated allograftsJ Exp Med20021951641164612070291NagahamaKNishimuraESakaguchiSInduction of tolerance by adoptive transfer of Treg cellsMethods Mol Biol200738043144217876110FontenotJDGavinMARudenskyAYFoxp3 programs the development and function of CD4+CD25+ regulatory T cellsNat Immunol2003433033612612578OdaJMHirataBKGuembarovskiRLWatanabeMAGenetic polymorphism in FOXP3 gene: imbalance in regulatory T-cell role and development of human diseasesJ Genet20139216317123640423HeYNaHLiYQiuZLiWFoxp3 rs3761548 polymorphism predicts autoimmune disease susceptibility: a meta-analysisHum Immunol2013741665167123993983BestardOCruzadoJMRamaITorrasJGomàMSerónDPresence of FoxP3+ regulatory T cells predicts outcome of subclinical rejection of renal allograftsJ Am Soc Nephrol2008192020202618495961GrimbertPMansourHDesvauxDRoudot-ThoravalFAudardVDahanKThe regulatory/cytotoxic graft-infiltrating T cells differentiate renal allograft borderline change from acute rejectionTransplantation20078334134617297410MansourHHomsSDesvauxDBadoualCDahanKMatignonMIntragraft levels of Foxp3 mRNA predict progression in renal transplants with borderline changeJ Am Soc Nephrol2008192277228118667728KrepsovaETycovaISekekovaAWohlfahrtPHrubaPStrizIEffect of induction therapy on the expression of molecular markers associated with rejection and toleranceBMC Nephrol20151614626286066IwaseHKobayashiTKoderaYMiwaYKuzuyaTIwasakiKClinical significance of regulatory T-cell-related gene expression in peripheral blood after renal transplantationTransplantation20119119119821157405MuthukumarTDadhaniaDDingRSnopkowskiCNaqviRLeeJBMessenger RNA for FOXP3 in the urine of renal-allograft recipientsN Engl J Med20053532342235116319383VeroneseFRotmanSSmithRNPelleTDFarrellMLKawaiTPathological and clinical correlates of FOXP3+ cells in renal allografts during acute rejectionAm J Transplant2007791492217286616QiuXYJiaoZZhangMChenJPShiXJZhongMKGenetic association of FOXP3 gene polymorphisms with allograft rejection in renal transplant patientsNephrology (Carlton)20121742343022239151EngelaAUBoerKRoodnatJIPeetersAMEilersPHKal-van GestelJAGenetic variants of FOXP3 influence graft survival in kidney transplant patientsHum Immunol20137475175723459079MisraMKMishraAPandeySKKapoorRSharmaRKAgrawalSAssociation of functional genetic variants of transcription factor Forkhead Box P3 and Nuclear Factor-κB with end-stage renal disease and renal allograft outcomeGene2016581576526794449SongEYParkMHKangSJParkHJKimBCTokunagaKHLA class II allele and haplotype frequencies in Koreans based on 107 familiesTissue Antigens20025947548612445317ChenXGanTLiaoZChenSXiaoJFoxp3 (-/ATT) polymorphism contributes to the susceptibility of preeclampsiaPLoS One20138e5969623560055GaoLLiKLiFLiHLiuLWangLPolymorphisms in the FOXP3 gene in Han Chinese psoriasis patientsJ Dermatol Sci201057515619880293WuZYouZZhangCLiZSuXZhangXAssociation between functional polymorphisms of Foxp3 gene and the occurrence of unexplained recurrent spontaneous abortion in a Chinese Han populationClin Dev Immunol2012201289645821876709InoueNWatanabeMMoritaMTomizawaRAkamizuTTatsumiKAssociation of functional polymorphisms related to the transcriptional level of FOXP3 with prognosis of autoimmune thyroid diseasesClin Exp Immunol201016240240620942809HoogendoornBColemanSLGuyCASmithKBowenTBucklandPRFunctional analysis of human promoter polymorphismsHum Mol Genet2003122249225412915441CoppoRAmoreAChiesaMLombardoFCirinaPAndrulliSSerological and genetic factors in early recurrence of IgA nephropathy after renal transplantationClin Transplant20072172873717988266AndréGMBarbosaCPTelesJSVilarinoFLChristofoliniDMBiancoBAnalysis of FOXP3 polymorphisms in infertile women with and without endometriosisFertil Steril2011952223222721481380ZhengLWangXXuLWangNCaiPLiangTFoxp3 gene polymorphisms and haplotypes associate with susceptibility of Graves' disease in Chinese Han populationInt Immunopharmacol20152542543125708657OwenCJEdenJAJenningsCEWilsonVCheethamTDPearceSHGenetic association studies of the FOXP3 gene in Graves' disease and autoimmune Addison's disease in the United Kingdom populationJ Mol Endocrinol2006379710416901927EastellTHinksAThomsonWBSPAR Study GroupSNPs in the FOXP3 gene region show no association with Juvenile Idiopathic Arthritis in a UK Caucasian populationRheumatology (Oxford)2007461263126517526924FadelFIElshamaaMFSalahANabhanMRasheedMKamelSFas/Fas Ligand pathways gene polymorphisms in pediatric renal allograft rejectionTranspl Immunol201637283427109035ParkHShinSParkMHKimYSAhnCHaJAssociation of IL-17F gene polymorphisms with renal transplantation outcomeTransplant Proc20144612112324507036
Kaplan-Meier survival analysis of graft survival according to <italic>Foxp3</italic> polymorphisms. (A) Patients with rs3761548 CC genotype (n=209) showed better graft survival than those with AC or AA genotype (n=22) (log rank test, <italic>P</italic>=0.03). (B) Patients with rs2280883 TT genotype (n=216) showed better graft survival than those with CT or CC genotype (n=15) (<italic>P</italic>=0.02).
Kaplan-Meier survival analysis of recurrence of original glomerular disease post kidney transplantation according to <italic>Foxp3</italic> polymorphism rs3761548.
Characteristics of the study population and univariate Cox proportional hazards regression analysis with regard to graft survival
Characteristics
Study population (n = 231)
P*
Recipient
Median age (IQR) [years]
38 (30–46)
0.329
Gender [M/F]
142/89
0.967
Graft failure [GF−/GF+]
208/23
n/a
Foxp3 polymorphism
rs3761548 [AC or AA/CC]
209/22
0.038
rs2280883 [CT or CC/TT]
216/15
0.032
rs5902434 [ATT/ATT/del/del or del/ATT]
173/58
0.254
rs2232365 [AG or GG/AA]
173/58
0.254
Primary diseases [NI/I]†
55/120
0.519
Induction therapy [-/+]
199/32
0.445
Donor
Median age (IQR) [years]
37 (27–48)
0.935
Gender [M/F]
224/7
0.086
Transplant
Graft origin [LD/CD]
203/28
0.904
Number of HLA-mismatches
2.6 ± 1.5
0.231
Acute rejection [AR-/AR+]
165/66
< 0.001
Crossmatch [+/−]‡
2/229
0.757
*Univariate Cox regression analysis; †56 (24.2%) cases could not be defined as either primary disease category; ‡All 231 cases were negative for cytotoxic crossmatch, and two cases were positive only for T-cell flowcytometric crossmatch.
Abbreviations: IQR, interquartile range; M, male; F, female; NI, non-inflammatory; I, inflammatory; n/a, not available; LD, living donor; CD, cadaveric donor.
Sequence-specific primers for <italic>Foxp3</italic> polymorphisms
Polymorphism
AT (℃)
Sequence (5′ → 3′)
rs3761548
C
59
F
CTGGCTCTCTCCCCAACTGA
R
ACAGAGCC CATCATCAGACTCTCTA
A
F
CTGGCTCTCTCCCCAACTGC
R
ACAGAGCC CATCATCAGACTCTCTA
rs2280883
C
64
F
GATCAAATGGGTGTTACAAGGIIIIITTGGGIAC
R
CAAGTTCCACAACATGCGACIIIIITTCACCTA
T
F
GATGATGATTGCAGTGAGGCTIIIIITCAGGATG
R
TATGTCAATACACCCCCAACTGIIIIICATTCICA
rs5902434
del
62
F
GAGAAAGAGAGGCAGAGAAACATIIIIAAGAGCAAG
R
AGGTCTTTAAAAAAATAATAGAATAAAIIIIIGAAGACTT
ATT
F
GCCATTTATTCTATTATTATTTTTTIIIIIACCTTACC
R
GTGGTGAGGGGAAGAAATCATIIIITCAGATGA
rs2232365
A
67
F
CTTCTACAGGCCCCAGCTCIIIIIACICCATC
R
AGTGACTAGGCATGGACTCAAAIIIIICATCTGGC
G
F
CAGCATGGCAAGTGACAGAGAIIIIIAGAGACGG
R
CCAGCATGGCAAGTGACAGAIIIIIGGAGATAC
Abbreviations: SNP, single nucleotide polymorphism; AT, annealing temperature; F, forward; R, reverse; del, deletion.
Association of <italic>Foxp3</italic> polymorphisms with graft rejection