jlc Journal of Lung Cancer J Lung Cancer 1598-7809 Korean Association for the Study of Lung Cancer 10.6058/jlc.2008.7.2.65 jlc-7-65 Original Article Detection of Serum Free DNA Hypermethylation in Surgically Resected Adenocarcinoma of the Lung ParkSun JungM.S. 1 2 KimYoung TaeM.D., Ph.D. 1 2 3 ParkJu-YeonM.S. 1 2 WiHyun ChoM.S. 1 2 KangChang HyunM.D., Ph.D. 3 SungSook-WhanM.D., Ph.D. 3 KimJoo HyunM.D., Ph.D. 3 Cancer Research Institute Transplantation Research Institute, Seoul National University College of Medicine Department of Thoracic and Cardiovascular Surgery, Clinical Research Institute, Seoul National University Hospital, Seoul, Korea Address for correspondence Young Tae Kim, M.D., Ph.D. Department of Thoracic and Cardiovascular Surgery, Seoul National University Hospital, 101 Daehang-ro, Jongno-gu, Seoul 110-744, Korea Tel: 82-2-2072-3161 Fax: 82-2-765-7117 E-mail: ytkim@snu.ac.kr

This paper was partially supported by a grant No. 04-2003-011-0 from the Seoul National University Hospital Research Fund and by the National R&D Program Grant of the Ministry of Science and Technology (R13-2002-025-03002-0).

 01 2008 10 01 2008 7 2 65 70 01122008 04122008 Copyright © 2008 Korean Association for the Study of Lung Cancer 2008 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Purpose

Aberrant DNA methylation patterns have been commonly associated with human cancers. We have investigated the frequency of DNA hypermethylation in promoter regions from adenocarcinomas of the lung and then attempted to detect the same epigenetic changes from patient serum samples.

 Materials and Methods

We collected tissues from 72 cases of lung adenocarcinomas. The cancer and normal lung tissues were tested for DNA hypermethylation using methylation-specific PCR (MSP). The genes investigated were DAPK, RARβ P2 and p16. We selected 12 patients where promoter hypermethylation was present for all three genes and four patients where hypermethylation was not seen for any of the three genes. Serum-free DNA was extracted and was tested for promoter hypermethylation. The status of serum-free DNA methylation was analyzed; the hypermethylation status was compared to clinical variables and cancer outcomes.

 Results

DNA hypermethylation was observed in 32% of samples for DAPK, 63% of samples for RARβ P2 and 83% of samples for p16 from the cancer tissues. Among the 12 matched serum samples where the primary tumor showed hypermethylation in all three gene promoter regions, we were able to detect five incidences of serum DNA hypermethylation in four patients. The four patients had TNM stage II or higher disease. None of the patients with stage I disease showed serum-free DNA hypermethylation.

 Conclusion

Aberrant promoter hypermethylation was frequently observed in surgically resected adenocarcinoma of the lung. Concurrent serum-free DNA hypermethylation was detected in 34% of patients where the primary tumor showed hypermethylation in all three gene promoter regions. The findings suggest that the serum-free DNA methylation status might be used as a potential target for the diagnosis of lung cancer. However, the low sensitivity should be improved for use in a clinical application.

 Lung cancer Adenocarcinoma Hypermethylation Epigenetics Serum DNA References Landis SH Murray T Bolden S Wingo PA Cancer statistics, 1999 CA Cancer J Clin 199949 831 Bunn PJ Jr Early detection of lung cancer using serum RNA or DNA markers: ready for "prime time" or for validation? J Clin Oncol 200321 38913893 Kim YT Lee SH Sung SW Kim JH Can aberrant promoter hypermethylation of CpG islands predict the clinical outcome of nonsmall cell lung cancer after curative resection? Ann Thorac Surg 200579 11801188 Kim YT Park SJ Lee SH Prognostic implication of aberrant promoter hypermethylation of CpG islands in adenocarcinoma of the lung J Thorac Cardiovasc Surg 2005130 1378 Jahr S Hentze H Englisch S DNA fragments in the blood plasma of cancer patients: quantitations and evidence for their origin from apoptotic and necrotic cells Cancer Res 200161 16591665 Sozzi G Conte D Leon M Quantification of free circulating DNA as a diagnostic marker in lung cancer J Clin Oncol 200321 39023908 Sozzi G Conte D Mariani L Analysis of circulating tumor DNA in plasma at diagnosis and during follow-up of lung cancer patients Cancer Res 200161 46754678 Bearzatto A Conte D Frattini M p16 (INK4A) Hypermethylation detected by fluorescent methylation-specific PCR in plasmas from nonsmall cell lung cancer Clin Cancer Res 20028 37823787 Beau-Faller M Gaub MP Schneider A Plasma DNA microsatellite panel as sensitive and tumor-specific marker in lung cancer patients Int J Cancer 2003105 361370 Gormally E Hainaut P Caboux E Amount of DNA in plasma and cancer risk: a prospective study Int J Cancer 2004111 746749 Gautschi O Bigosch C Huegli B Circulating deoxyribonucleic Acid as prognostic marker in nonsmall-cell lung cancer patients undergoing chemotherapy J Clin Oncol 200422 41574164 Herrera LJ Raja S Gooding WE Quantitative analysis of circulating plasma DNA as a tumor marker in thoracic malignancies Clin Chem 200551 113118 Chen XQ Stroun M Magnenat JL Microsatellite alterations in plasma DNA of small cell lung cancer patients Nat Med 19962 10331035 Sozzi G Musso K Ratcliffe C Goldstraw P Pierotti MA Pastorino U Detection of microsatellite alterations in plasma DNA of nonsmall cell lung cancer patients: a prospect for early diagnosis Clin Cancer Res 19995 26892692 Andriani F Conte D Mastrangelo T Detecting lung cancer in plasma with the use of multiple genetic markers Int J Cancer 2004108 9196 Cuda G Gallelli A Nistico A Detection of microsatellite instability and loss of heterozygosity in serum DNA of small and nonsmall cell lung cancer patients: a tool for early diagnosis? Lung Cancer 200030 211214 Ramirez JL Sarries C de Castro PL Methylation patterns and K-ras mutations in tumor and paired serum of resected nonsmall-cell lung cancer patients Cancer Lett 2003193 207216 Kimura T Holland WS Kawaguchi T Mutant DNA in plasma of lung cancer patients: potential for monitoring response to therapy Ann N Y Acad Sci 20041022 5560 Silva JM Gonzalez R Dominguez G Garcia JM Espana P Bonilla F TP53 gene mutations in plasma DNA of cancer patients Genes Chromosomes Cancer 199924 160161 An Q Liu Y Gao Y Detection of p16 hypermethylation in circulating plasma DNA of nonsmall cell lung cancer patients Cancer Lett 2002188 109114 Esteller M Sanchez-Cespedes M Rosell R Sidransky D Baylin SB Herman JG Detection of aberrant promoter hypermethylation of tumor suppressor genes in serum DNA from nonsmall cell lung cancer patients Cancer Res 199959 6770 Usadel H Brabender J Danenberg KD Quantitative adenomatous polyposis coli promoter methylation analysis in tumor tissue, serum, and plasma DNA of patients with lung cancer Cancer Res 200262 371375 Xue X Zhu YM Woll PJ Circulating DNA and lung cancer Ann N Y Acad Sci 20061075 154164 Figures and Tables Figures and Tables

Result of MSP analyses of serum-free DNA for three genes: DAPK, RARβ P2 and p16.

Summary of the methylation status for DAPK, RARβ P2 and p16 in primary tumor and serum samples. The black-colored boxes represent methylated samples.

Summary of Primer Sequences, Annealing Temperatures and PCR Product Sizes Used for MSP

Gene Forward primer (5'→3') Reverse primer (5'→3') Annealing temperature (o C) Product size (bp)
p16 M: TTATTAGAGGGTGGGGCGGATCGC M: GACCCCGAACCGCGACCGTAA 62 150
  U: TTATTAGAGGGTGGGGTGGATTGT U: CAACCCCAAACCACAACCATAA 60 151
RARß P2 M: TCGAGAACGCGAGCGATTCG M: GACCAATCCAACCGAAACGA 59 146
  U: TTGAGAATGTGAGTGATTTGA U: AACCAATCCAACCAAAACAA 55 146
DAPK M: GGATAGTCGGATCGAGTTAACGTC M: CCCTCCCAAACGCCGA 57 98
  U: GGAGGATAGTTGGATTGAGTTAATGTT U: CAAATCCCTCCCAAACACCAA 55 106

bp: base pair, DAPK: death-associated protein kinase, RARβ P2: retinoic acid receptor β-promoter

Methylation Frequency of the Cancer Tissues According to the TNM Stage

Gene Early stage Advanced stage p value*
Stage Ia (13) Stage Ib (19) Stage IIb (11) Stage IIIa (22) Stage IIIb (6) Stage IV (1)
p16 11 (84.6%) 17 (89.5%) 8 (72.7%) 18 (81.8%) 5 (83.3%) 1 (100.0%) 0.914
RARβ P2 10 (76.9%) 12 (63.2%) 6 (54.5%) 12 (54.5%) 4 (66.7%) 1 (100.0%) 0.577
DAPK 3 (23.1%) 7 (36.8%) 4 (36.4%) 8 (36.4%) 2 (33.3%) 0 (0.0%) 0.865

p values were calculated by using the chi-squared test for proportion difference between the early and the advanced stages

Serum Free DNA Hypermethylation Status According to the TNM Stage

  Number of patients Patient No. (Hypermethylated gene)
Stage I 4 None
Stage II 2 #7 (p16)
Stage III 6 #8, #14 (RARβ P2)
    #16 (RARβ P2, DAPK)