jbv Journal of Bacteriology and Virology J Bacteriol Virol 1598-2467 2093-0249 Journal of Bacteriology and Virology 10.4167/jbv.2016.46.4.231 jbv-46-231 Original Article Establishment of a Multiplex RT-PCR for the Sensitive and Differential Detection of Japanese Encephalitis Virus Genotype 1 and 3 YangDong-Kun ∗ KimHa-Hyun JoHyun-Ye ChoiSung-Suk ChoIn-Soo Viral Disease Division, Animal and Plant Quarantine Agency, Gyeongsangbuk-do, Korea Corresponding author: Dong-Kun Yang, PhD, DVM. Viral Disease Division, Animal and Plant Quarantine Agency, 177 Hyeoksin 8-ro, Gimcheon-si, Gyeongsangbuk-do, 39660, Korea. Phone: +82-54-912-0785, Fax: +82-54-912-0812, e-mail: yangdk@korea.kr

This study was supported by a grant (N-1543083-2014-18-01) from the Animal and Plant Quarantine Agency, Ministry of Agriculture, Food, and Rural Affairs (MAFRA), Republic of Korea.

 22016 922016 464 231238 27062016 22072016 25102016 Copyright © 2016 Journal of Bacteriology and Virology 2016 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract

Japanese encephalitis (JE) is a zoonosis that affects the nervous system of humans and other animals. The genotype of JE virus (JEV) has shifted recently from genotype 3 (G3) to genotype 1 (G1) in Asia, including Korea. Thus, a rapid differential assay is required to make an accurate diagnosis of JEV genotype. In this study, we designed common and differential primer sets for JEV G1 and G3 to detect the JEV envelope (E) gene. The specific primer sets for JEV G1 and G3 specifically amplified the target gene. The detection limits of the three primer sets were 101.0, 102.0, and 102.0 TCID50/ reaction, respectively. No cross-reactivity was detected with non-JEV reference viruses. The multiplex reverse transcription-polymerase chain reaction (RT-PCR) assay specifically differentiated JEV G1 from G3. Thus, a one-step multiplex RT-PCR assay was established to rapidly and differentially detect JEV. This assay will be useful for confirming JEV infections in animals and checking the JEV genotype in veterinary biological products.

 Japanese encephalitis virus Multiplex RT-PCR Genotype REFERENCES Han N Adams J Chen P Guo ZY Zhong XF Fang W Comparison of genotypes I and III in Japanese encephalitis virus reveals distinct differences in their genetic and host diversity J Virol 201488 1146979 Morita K Nabeshima T Buerano CC Japanese encephalitis Rev Sci Tech 201534 44152 Aubry M Finke J Teissier A Roche C Broult J Paulous S Seroprevalence of arboviruses among blood donors in French Polynesia, 2011–2013 Int J Infect Dis 201541 112 Ravanini P Huhtamo E Ilaria V Crobu MG Nicosia AM Servino L Japanese encephalitis virus RNA detected in Culex pipiens mosquitoes in Italy Euro Surveill 201217 pii: 20221. Gulati BR Singha H Singh BK Virmani N Kumar S Singh RK Isolation and genetic characterization of Japanese encephalitis virus from equines in India J Vet Sci 201213 1118 Allison SL Schalich J Stiasny K Mandl CW Heinz FX Mutational evidence for an internal fusion peptide in flavivirus envelope protein E J Virol 200175 426875 Chen WR Tesh RB Rico-Hesse R Genetic variation of Japanese encephalitis virus in nature J Gen Virol 199071Pt 12 291522 Hasegawa H Yoshida M Fujita S Kobayashi Y Comparison of structural proteins among antigenically different Japanese encephalitis virus strains Vaccine 199412 8414 Kang BK Hwang JM Moon H Han SY Kim JM Yang DK Comparison of the antigenic relationship between Japanese encephalitis virus genotypes 1 and 3 Clin Exp Vaccine Res 20165 2630 Nah JJ Yang DK Kim HH Song JY The present and future of veterinary vaccines for Japanese encephalitis in Korea Clin Exp Vaccine Res 20154 1306 Zeng Z Liu Z Wang W Tang D Liang H Liu Z Establishment and application of a multiplex PCR for rapid and simultaneous detection of six viruses in swine J Virol Methods 2014208 1026 Kim HC Takhampunya R Tippayachai B Chong ST Park JY Kim MS Japanese encephalitis virus in culicine mosquitoes (Diptera: culicidae) of the republic of Korea, 2008–2010 Mil Med 2015180 15867 Yang DK Kim BH Kweon CH Kwon JH Lim SI Han HR Molecular characterization of full-length genome of Japanese encephalitis virus (KV1899) isolated from pigs in Korea J Vet Sci 20045 197205 Yun SM Cho JE Ju YR Kim SY Ryou J Han MG Molecular epidemiology of Japanese encephalitis virus circulating in South Korea, 1983–2005 Virol J 20107 127 Yang DK Kweon CH Kim BH Lim SI Kim SH Kwon JH TaqMan reverse transcription polymerase chain reaction for the detection of Japanese encephalitis virus J Vet Sci 20045 34551 Zell R Global climate change and the emergence/re-emergence of infectious diseases Int J Med Microbiol 2004293 Suppl 37 1626 Zheng H Shan T Deng Y Sun C Yuan S Yin Y Molecular characterization of Japanese encephalitis virus strains prevalent in Chinese swine herds J Vet Sci 201314 2736 Konishi E Kitai Y Tabei Y Nishimura K Harada S Natural Japanese encephalitis virus infection among humans in west and east Japan shows the need to continue a vaccination program Vaccine 201028 266470 Yang DK Nah JJ Kim HH Song JY Inactivated genotype 1 Japanese encephalitis vaccine for swine Clin Exp Vaccine Res 20143 2129 Chen YY Lin JW Fan YC Chiou SS Detection and differentiation of genotype I and III Japanese encephalitis virus in mosquitoes by multiplex reverse transcriptase-polymerase chain reaction Transbound Emerg Dis 201461 3743 Wittwer CT Herrmann MG Gundry CN Elenitoba-Johnson KS Real-time multiplex PCR assays Methods 200125 43042 Das S Pingle MR Munoz-Jordan J Rundell MS Rondini S Granger K Detection and serotyping of dengue virus in serum samples by multiplex reverse transcriptase PCR-ligase detection reaction assay J Clin Microbiol 200846 327684 Johnson BW Russell BJ Lanciotti RS Serotype-specific detection of dengue viruses in a fourplex real-time reverse transcriptase PCR assay J Clin Microbiol 200543 497783 Kim H Cha GW Jeong YE Lee WG Chang KS Roh JY Detection of Japanese encephalitis virus genotype V in Culex orientalis and Culex pipiens (Diptera: Culicidae) in Korea PLoS One 201510 e0116547 Figures and Tables

The amplification sites of JEV gene for multiplex RT-PCR in JEV full genome.

Setting up annealing temperature to optimize temperature condition for detection of JEV genotypes. After conducting RT-PCR at three annealing temperature conditions (lane 1: 50°C, lane 2: 57°C, and lane 3: 62°C), the PCR products were visualized on the 1.8% agarose gel. JEV G3 cannot be amplified by RT-PCR of annealing temperature at 50°C and common parts of JEV G1 and G3 cannot be amplified distinctly at 62°C. Annealing temperature at 57°C turned to be reliable for detection of two JEV genotypes.

Sensitivity of the specific primer sets for detection of genotypes of JEV. Differential RT-PCR between JEV G1 and G3 (A, B, C and D). Sensitivity of primer sets for common and genotypes was set up based on the annealing temperature. M; 100 bp DNA ladder, lane 1–5; 10-fold serial dilutions of extracted RNA of JEV (106.0 TCID50/ml).

Specificity of differential JEV RT-PCR using three kinds of primer sets. The RT-PCR detected only genotype of JEV and did not have positive signal for any other viral pathogens. The seven viruses showing titer of 105.0 TCID50/ml or over were used to extract RNA or DNA. M; 100 bp DNA ladder, lane 1; classical swine fever virus, lane 2; porcine parvovirus, lane 3; encephalomyocarditis virus, lane 4; Aujezsky's disease virus, lane 5; transmissible gastroenteritis virus, lane 6; porcine epidemic diarrhea virus, lane 7; porcine reproductive and respiratory syndrome virus, lane 8; JEV G1 and 3, lane 9; JEV G1, lane 10; JEV G3, lane 11; distilled water (negative control).

Application of multiplex RT-PCR to commercial JE vaccines. Five JE vaccines and one Korean field strain (K95) showed positive reactions in the multiplex RT-PCR kit. M; 100 bp DNA ladder, lane 1; Anyang 300 strain, lane 2; KV1899 strain, lane 3; K95 strain, lane 4; Greencross® Porcine JE, lane 5; Daesung JE pig vac, lane 6; Suishot® JE, lane 7; Provac® JE, lane 8; Himmvac® JE.

The design of the three JEV specific primer sets for differential detection of JEV in multiplex RT-PCR

Name of primer Genotype Oligonucleotide sequences (5′ – 3′) Discrepancy rate (%) Position in E gene
JEcomF G1 CCAACACTAGATGTCCGCATGA    
G3 CCAACATTGGACGTCCGCATGA 3/22 (13.6) 115~135
Primer CCAACAY∗ TR∗∗ GAYGTCCGCATGA    
JEcomR G1 CATCAAGTACAAGGTTGGC    
G3 CATCAAATACGAAGTTGGC 2/19 (10.5) 402~420
Primer CATCAAYTACYAYGTTGGC    
JEG1F G1 GCGTCTCAAGCAGCAAAGTTTACT    
G3 GCGTCCCAGGCGGCAAAGTTTACA 4/24 (16.7) 481~504
Primer GCGTCTCAAGCAGCAAAGTTTACT    
JEG1R G1 TGTCTCAGTCGCGAGTTTAAACGAC    
G3 CGTCTCCGTTGCGAGCCTCAATGAC 7/25 (28.0) 1017~1043
Primer TGTCTCAGTCGCGAGTTTAAACGAC    
JEG3F G1 CCGATTGTCTCAGTCGCGAGTT    
G3 CCGATCGTCTCCGTTGCGAGCC 5/22 (22.7) 1012~1033
Primer CCGATCGTCTCCGTTGCGAGCC    
JEG3R G1 CCTGGCTTTTCTGGCCACGG    
G3 TTTGGCCTTCTTAGCCACAG 7/20 (35.0) 1443~1462
Primer TTTGGCCTTCTTAGCCACAG    

: Y; C or T

: R; A or G.