kjlm The Korean Journal of Laboratory Medicine Korean J Lab Med 2383-5702 2383-5710 The Korean Society for Laboratory Medicine 10.3343/kjlm.2010.30.2.111 kjlm-30-111 Case Report Molecular Analysis of Two Cases of Severe Congenital Neutropenia ParkJoonhong M.D. 1 KimMyungshin M.D. 1 LimJihyang M.D. 1 KimYonggoo M.D. 1 ChoBin M.D. 2 ParkYeon-Joon M.D. 1 HanKyungja M.D. 1 Departments of Laboratory Medicine and Pediatrics, Seoul, Korea College of Medicine, The Catholic University of Korea, Seoul, Korea Corresponding author: Kyungja Han, M.D. Department of Laboratory Medicine, College of Medicine, The Catholic University of Korea, 505 Banpo-dong, Seocho-gu, Seoul 137-701, Korea Tel: +82-2-2258-1644, Fax: +82-2-2258-1719 E-mail: hankja@catholic.ac.kr 012010 14012010 302 111116 29042009 11012010 4022010 Copyright © 2010 Korean Society for Laboratory Medicine 2010 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract

Severe congenital neutropenia is a rare hematological disease characterized by a selective decrease in circulating neutrophils, maturation arrest of granulocytic precursors at the promyelocyte stage, and recurrence of infections. A 2-month-old male infant (patient A) and a 14-month-old female child (patient B) were referred to our hospital due to severe neutropenia. Sequencing analysis of ELA2 and HAX1 genes was performed. Two single nucleotide polymorphisms of HAX1 gene were found. They were 5,104T→G point mutation of exon 1 and 5,474A→G point mutation of intron 1 in HAX1 gene. The mutation of ELA2 gene was not found. The patient A showed a good response to granulocyte colony-stimulating factor (G-CSF) treatment and the absolute neutrophil count recovered to 1,195/μL But the patient B showed a partial response to G-CSF treatment and experienced several episodes of herpetic gingivostomatitis, oral ulcer, acute pharyngotonsillitis and otitis media during follow-up.

 Severe congenital neutropenia ELA2 HAX1 REFERENCES Boxer LA Severe congenital neutropenia: genetics and pathogenesis Trans Am Clin Climatol Assoc 2006 1171331 Kostmann R Infantile genetic agranulocytosis. A review with presentation of ten new cases Acta Paediatr Scand 1975 643628 Dale DC Person RE Bolyard AA Aprikyan AG Bos C Bonilla MA Mutations in the gene encoding neutrophil elastase in congenital and cyclic neutropenia Blood 2000 96231722 Horwitz MS Duan Z Korkmaz B Lee HH Mealiffe ME Salipante SJ Neutrophil elastase in cyclic and severe congenital neutropenia Blood 2007 109181724 Klein C Grudzien M Appaswamy G Germeshausen M Sandrock I Schaffer AA HAX1 deficiency causes autosomal recessive severe congenital neutropenia (Kostmann disease) Nat Genet 2007 398692 Germeshausen M Grudzien M Zeidler C Abdollahpour H Yetgin S Rezaei N Novel HAX1 mutations in patients with severe congenital neutropenia reveal isoform-dependent genotype-phenotype associations Blood 2008 11149547 Kawaguchi H Kobayashi M Nakamura K Konishi N Miyagawa S Sato T Dysregulation of transcriptions in primary granule constituents during myeloid proliferation and differentiation in patients with severe congenital neutropenia J Leukoc Biol 2003 7322534 Ishikawa N Okada S Miki M Shirao K Kihara H Tsumura M Neurodevelopmental abnormalities associated with severe congenital neutropenia due to the R86X mutation in the HAX1 gene J Med Genet 2008 458027 Kostmann R Infantile genetic agranulocytosis (agranulocytosis infantilis hereditaria): a new recessive lethal disease in man Acta Pediatr Scand. 1956 45178 Boxer L and Dale DC Neutropenia: causes and consequences Semin Hematol 2002 397581 Freedman MH Bonilla MA Fier C Bolyard AA Scarlata D Boxer LA Myelodysplasia syndrome and acute myeloid leukemia in patients with congenital neutropenia receiving G-CSF therapy Blood 2000 9642936 Freedman MH and Alter BP Risk of myelodysplastic syndrome and acute myeloid leukemia in congenital neutropenias Semin Hematol 2002 3912833 Yoo HW Shin SM Ahn HS Choi Y Hong CY A case of Kostmann syndrome J Korean Pediatr Soc 1983 262848 (유한욱, 신손문, 안효섭, 최용, 홍창의. Kostmann 증후군1례. 소아과 1983;26:284-8.) Shin WS Kim SW Paik IK A case of Kostmann syndrome J Korean Pediatr Soc 1989 32156873 (신원섭, 김상우, 백인기. Kostmann 증후군1례. 소아과 1989;32:1568-73.) Kim SC Kim MY Song KE Suh JS Lee WK Kim JS A case of congenital neutropenia Korean J Clin Pathol 1989 93859 (김성철, 김문연, 송경은, 서장수, 이원길, 김재식. 선천성 호중구 감소증 1예. 대한임상병리학회지 1989;9:385-9.) Yoon CG Jang JG Sin JB Lee SY Kostmann's disease: a case report Korean J Pediatr Hematol-Oncol 1999 613640 (윤철규, 장진규, 신종범, 이순용. Kostmann병. 대한소아혈액종양학회지 1999;6:136-40.) Lee JH Cho B Sung IK Kim HK Lee KS Han KJ A case of Kostmann syndrome treated with recombinant human granulocyte colony-stimulating factor Korean J Perinatol 1996 718893 (이정화, 조 빈, 성인경, 김학기, 이경수, 한경자. 과립구집락자극인자로치료한 Kostmann 증후군1례. 대한주산의학회잡지 1996;7:188-93.) Dale DC Bonilla MA Davis MW Nakanishi AM Hammond WP Kurtzberg J A randomized controlled phase III trial of recombinant human granulocyte colony-stimulating factor (filgrastim) for treatment of severe chronic neutropenia Blood 1993 812496502 Freedman MH Safety of long-term administration of granulocyte colony-stimulating factor for severe chronic neutropenia Curr Opin Hematol 1997 421724 Welte K and Dale D Pathophysiology and treatment of severe chronic neutropenia Ann Hematol 1996 7215865 Welte K and Boxer LA Severe chronic neutropenia: pathophysiology and therapy Semin Hematol 1997 3426778 Welte K Zeidler C Dale DC Severe congenital neutropenia Semin Hematol 2006 4318995 Zeidler C Welte K Barak Y Barriga F Bolyard AA Boxer L Stem cell transplantation in patients with severe congenital neutropenia without evidence of leukemic transformation Blood 2000 9511958 Seo JJ Moon SH Cha SW Ko KO Chung YH Anh HS Effect of granulocyte colony-stimulating factor in a patient with congenital agranulocytosis Korean J BRM 1994 412330 (서종진, 문신혜, 차상원, 고경옥, 정용헌, 안효섭 외. 선천성 무과립구증에 대한 과립구 집락자극인자(G-CSF)의치료. 한국BRM 학회지 1994;4:123-30.) Ancliff PJ Gale RE Liesner R Hann IM Linch DC Mutations in the ELA2 gene encoding neutrophil elastase are present in most patients with sporadic severe congenital neutropenia but only in some patients with the familial form of the disease Blood 2001 98264550 Dong F Brynes RK Tidow N Welte K Lowenberg B Touw IP Mutations in the gene for the granulocyte colony-stimulating-factor receptor in patients with acute myeloid leukemia preceded by severe congenital neutropenia N Engl J Med 1995 33348793 Devriendt K Kim AS Mathijs G Frints SG Schwartz M Van Den Oord JJ Constitutively activating mutation in WASP causes X-linked severe congenital neutropenia Nat Genet 2001 273137 Person RE Li FQ Duan Z Benson KF Wechsler J Papadaki HA Mutations in proto-oncogene GFI1 cause human neutropenia and target ELA2 Nat Genet 2003 3430812 Skokowa J Cario G Uenalan M Schambach A Germeshausen M Battmer K LEF-1 is crucial for neutrophil granulocytopoiesis and its expression is severely reduced in congenital neutropenia Nat Med 2006 1211917 Lee ST Yoon HS Kim HJ Lee JH Park JH Kim SH A novel mutation Ala57Val of the ELA2 gene in a Korean boy with severe congenital neutropenia Ann Hematol 2009 885935 Figures and Tables

Bone marrow smears show markedly decreased granulocytic precursors (A and C, Wright stain, ×400) and a few promyelocytes (B and D, Wright stain, ×1,000) in patient A and B, respectively.

Sequencing analysis of HAX1. 5,104T→G point mutation of exon 1 (A, C) and 5,474A→G point mutation of intron 1 (B, D) in patient A and B, respectively. The point mutations of patient A are heterozygous and those of patient B are homozygous mutations.

Primers for PCR amplification and sequencing of ELA2 and HAX1 genes

Primers for PCR amplification Sequence Nucleotides
ELA2    
Forward primer CTCGCGTGTCTTTTCCTC 57-74
Reverse primer AGCCCTTCTCAGTGGGTC 833-850
HAX1    
Forward primer CGTTTACGACAGTGTCAGGATCG 5,017-5,039
Reverse primer TGACAAACTGACATGGCCCCAG 8,253-8,274
Primers for sequencing Sequence Nucleotides
ELA2    
1 Forward primer CTCGCGTGTCTTTTCCTC 57-74
Reverse primer GACGTTTACATTCGCCAC 252-269
2 Forward primer CCCAACTTCGTCAT GTCG 222-239
Reverse primer AGGCACTGCACCCCGTTG 476-493
3 Forward primer ATCAACGCCAACGTGCAG 423-440
Reverse primer GATTAGCCCGTTGCAGAC 657-674
4 Forward primer AACGTCTGCACTCTCGTG 591-608
Reverse primer AGCCCTTCTCAGTGGGTC 833-850
HAX1    
1 Forward primer CGTTTACGACAGTGTCAGGATCG 5,017-5,039
Reverse primer GAAAGGTGGCAGGTGTTTGC 6,187-6,206
2 Forward primer TTTTGATG TGGCAGCCAGTC 5,634-5,653
Reverse primer GGCTGGTCTC CAACTCCTG 6,535-6,553
3 Forward primer CCCTAAGGGGCAACCTGTG 6,049-6,067
Reverse primer CTACAA AGAGAAGTCCCCAC 7,811-7,830
4 Forward primer GAAGGAGTGTGTAAATAAGGC 7,242-7,262
Reverse primer TGACAAACTGACATGGCCCCAG 8,253-8,274

Nucleotide position corresponds to GenBank entry NM_001972 (ELA2) and NG_007369.1 (HAX1).