JKOS Journal of the Korean Ophthalmological Society J Korean Ophthalmol Soc 0378-6471 2092-9374 Korean Ophthalmological Society 10.3341/jkos.2017.58.3.313 jkos-58-313 Original Article Association of the GSTM1 and GSTT1 Genes with Diabetic Retinopathy in the Korean Population KimYung Hui MD 1 YangJee Myung MD 1 2 JangJae Yong MD 1 JiYong-Sok M D PhD 1 Department of Ophthalmology, Chonnam National University Medical School, Gwangju, Korea Graduate School of Medical Science and Engineering, Korea Advanced Institute of Science and Technology, Daejeon, Korea Address reprint requests to Yong-Sok Ji, MD, PhD Department of Ophthalmology, Chonnam National University Hospital, #42 Jebong-ro, Dong-gu, Gwangju 61469, Korea Tel: 82-62-220-6742, Fax: 82-62-227-1642 E-mail: redvein@naver.com 09 2017 7 9 2017 58 3 313 320 17 11 2016 24 01 2017 24 1 2017 Copyright © 2017 Korean Ophthalmological Society 2017 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Purpose

To investigate the correlation between Glutathione-S-transferase (GST) genes and diabetic retinopathy (DR) in pa-tients with type 2 diabetes mellitus (DM).

 Methods

In this case-control study, 131 patients who were diagnosed with DR, 105 diabetic patients who did not have DR, and 45 nondiabetic controls were examined from January 2013 to November 2015. To analyze deletion of the GSTT1 and GSTM1 genes, polymerase chain reactions of DNA in a buffy coat from peripheral blood were performed via electrophoresis.

 Results

There were no statistically significant differences in age, sex, or spherical equivalent between the 236 type 2 diabetic patients and the 45 normal controls ( p > 0.05). In both univariate and multivariate analyses, the duration of type 2 DR was longer ( p = 0.004, p = 0.013), and HbA1c was higher ( p = 0.004, p = 0.007) in the DR group than in the non-DR group. Presence of a GSTM1 deletion is associated with a lower frequency of DR ( p = 0.017, p = 0.012).

 Conclusions

Deletion of the GSTT1 gene is not associated with an increased risk of DR, whereas GSTM1 deletion is associated with a lower risk of DR in patients with type 2 DM in the Korean population. Additional studies with larger sample sizes and differ-ent types of GST genes are needed to confirm this study.

 Deletion Diabetes mellitus Glutathione-S-transferase Retinopathy References The effect of intensive treatment of diabetes on the development and progression of long-term complications in insulin-dependent diabetes mellitus The Diabetes Control and Complications Trial Research GroupN Engl J Med199332997786 Intensive blood-glucose control with sulphonylureas or insulin compared with conventional treatment and risk of complications in patients with type 2 diabetes (UKPDS 33)UK Prospective Diabetes Study (UKPDS) Group. Lancet199835283753 WeiMGaskillSPHaffnerSMSternMPEffects of diabetes and level of glycemia on all-cause and cardiovascular mortality. The San Antonio Heart StudyDiabetes Care199821116772 EbaraTCondeKKakoYDelayed catabolism of apoB-48 lipoproteins due to decreased heparin sulfate proteoglycan pro-duction in diabetic miceJ Clin Invest2000105180718 GinsbergHNInsulin resistance and cardiovascular diseaseJ Clin Invest20001064538 AllenRGTresiniMOxidative stress and gene regulationFree Radic Biol Med20002846399 SalinasAEWongMGGlutathione S-transferase--a reviewCurr Med Chem19996279309 DattaSKKumarVPathakRAssociation of glutathione S-transferase M1 and T1 gene polymorphism with oxidative stress in diabetic and nondiabetic chronic kidney diseaseRen Fail201032118995 LandiSMammalian class theta GST and differential suscepti-bility to carcinogens: a reviewMutat Res200046324783 RebbeckTRMolecular epidemiology of the human glutathione S-transferase genotypes GSTM1 and GSTT1 in cancer susceptibilityCancer Epidemiol Biomarkers Prev1997673343 ChenKJiangQTMaXYAssociations between genetic polymorphisms of glutathione S-transferase M1 and T1, smoking and susceptibility to colorectal cancer: a case-control studyZhonghua Zhong Liu Za Zhi2004266458 WhiteNHSunWClearyPAProlonged effect of intensive therapy on the risk of retinopathy complications in patients with type 1 diabetes mellitus: 10 years after the diabetes control and complications TrialArch Ophthalmol2008126170715 BekrisLMShephardCPetersonMGlutathione-s-trans-ferase M1 and T1 polymorphisms and associations witih type 1 diabetes age-at-onsetAutoimmunity20053856775 Grading diabetic retinopathy from stereoscopic color fundus pho-tographs--an extension of the modified Airlie House classification. ETDRS report number 10. Early Treatment Diabetic Retinopathy Study Research GroupOphthalmology199198(5 Suppl)786806 Clustering of long-term complications in families with diabetes in the diabetes control and complications trialThe Diabetes Control and Complications Trial Research Group. Diabetes199746182939 AbharySHewittAWBurdonKPCraigJEA systemic meta-anal-ysis of genetic association studies for diabetic retinopathyDiabetes200958213747 HuangYCLinJMLinJHGenome-wide association study of diabetic retinopathy in a Taiwanese populationOphthalmology20111186428 GrassiMATikhomirovARamalingamSGenome-wide meta-analysis for severe diabetic retinopathyHum Mol Genet201120247281 HovnikTDolzanVBratinaNUGenetic polymorphisms in genes encoding antioxidant enzymes are associated with diabetic retinopathy in type 1 diabetesDiabetes Care200932225862 CilenšekIMankočSPetrovičMGPetrovičD.GSTT1 null geno-types is a risk factor for diabetic retinopathy in Caucasians with type 2 diabetes, whereas GSTM1 null genotype might confer protectionagainstretinopathyDis Markers201232939 DadbinpourAShiekhhaMHDarbouyMAfkhami-ArdekaniM.Investigating GSTT1 and GSTM1 null genotype as the risk factor of diabetes type 2 retinopathyJ Diabetes Metab Disord20131248 MoasserEAzarpiraNShiraziBGenetic polymorphisms of glutathione-s-transferase M1 and T1 genes with risk of diabetic retinopathy in Iranian populationIran J Basic Med Sci2014173516 DoneyASLeeSLeeseGPIncreased cardiovascular mor-bidity and mortality in type 2 diabetes is associated with the gluta-thione S transferase theta-null genotype: a Go-DARTS studyCirculation2005111292734 SunLZhangYXiongYGSTM1 and GSTT1 nul genotype and diabetic retinopathy: a meta-analysisInt J Clin Exp Med20158167783 LewisSJCherryNMNivenRMGSTM1, GSTT1 and GSTP1 polymorphisms and lung cancer riskCancer Lett200218016571 LinHJProbst-HenschNMLouieADGlutathione trans-ferase null genotype, broccoli, and lower prevalence of colorectal adenomasCancer Epidemiol Biomarkers Prev1998764752 LondonSJYuanJMChungFLIsothiocyanates, glutathione S-transferase M1 and T1 polymorphisms, and lung-cancer risk: a prospective study of men in Shanghai, ChinaLancet20003567249 YadavDSDeviTRIhsanRPolymorhpisms of gluta-thione-S-transferase genes and the risk of aerodigestive tract can-cers in the Northeast Indian populationGenet test Mol Biomarkers20101471523 XiaoDSinghSVPhenethyl isothiocyanate inhibits angiogenesis in vitro and ex vivoCancer Res200767223946 MedeirosRSoaresRVasconcelosAGlutathione S-trans-ferase genotype GSTM1 as a predictor of elevated angiogenic phe-notype in patients with early onset breast cancerAngiogenesis20047538 PoulakiVQinWJoussenAMAcute intensive insulin ther-apy exacerbates diabetic blood-retinal barrier breakdown via hypo-xia-inducible factor-1alpha and VEGFJ Clin Invest200210980515 Gubitosk-KlugRATalahalliRDuY5-Lipoxygenase, but not 12/15-lipoxygenase, contributes to degeneration of retinal ca-pillaries in a mouse model of diabetic retinopathyDiabetes200857138793 TalahalliRZariniSSheibaniNSIncreased synthesis of leu-kotrienes in the mouse model of diabetic retinopathyInvest Ophthalmol Vis Sci2010511699708 JoachimARuttkowskiBProstaglandin D(2) synthesis in oeso-phagostomum dentatum is mediated by cytosolic glutathione S-transferaseExp Parasitol20111276046 Otto-KnappRJurgovskyKSchierhornKKunkelG.Antioxidative enzymes in human nasal mucosa after exposure to ozone: possible role of GSTM1 deficiencyInflamm Res200352515 MacLeodSSinhaRKadlubarFFLangNPolymorphisms of CYP1A1 and GSTM1 influence the in vivo function of CYP1A2Mutat Res199737613542 JeeDLeeWKKangSPrevalence and risk factors for diabetic retinopathy: the Korean National Health and Nutrition Examination Survey 2008-2011Invest Ophthalmol Vis Sci201354682733 PetrovicMGGilensekIPetrovicDManganese superoxide dis-mutase gene polymorphism (V16A) is associated with diabetic ret-inopathy in Slovene (Caucasians) type 2 diabetes patientsDis Markers2008245964 ChistiakovDAZotovaEV Savost’anov KV,The 262T>C promoter polymorphism of the catalase gene is associated with dia-betic neuropathy in type 1 diabetic Russian patientsDiabetes Metab200632638 NomiyamaTTanakaYPiaoLThe polymorphism of man-ganese superoxide dismutase is associated with diabetic nephrop-athy in Japanese type 2 diabetic patientsJ Hum Genet20034813841 KowluruRAKowluruVXiongYHoYSOverexpression of mi-tochondrial superoxide dismutase in mice protects the retina from diabetes-induced oxidative stressFree Radic Biol Med20064111916 Figures and Tables

A multiplex polymerase chain reaction (PCR) analysis of GSTM1 and GSTT1 gene polymorphism. GSTT1 and GSTM1 PCR products were analyzed by electrophoresis on a 1.5% agar-ose gel. Lane M is a 60 base-pair DNA ladder (molecular weight marker). Lane 1 GSTT1-present/GSTM1-present, Lane 2 GSTT1- null/GSTM1-present, Lane 3 GSTT1-present/GSTM1- null, Lane 4 GSTT1-null/GSTM1-null sample. GSTT1 = glutathione-S-trans-ferase theta 1; GSTM1 = glutathione-S-transferase mu 1.

Primer sequen ces for GST multiplex PCR

Primer Sequence
GSTM1 forward primer GAACTCCCTGAAAAGCTAAAGC
GSTM1 reverse primer GTTGGGCTCAAATATACGGTGG
GSTT1 forward primer TTCCTTACTGGTCCTCACATCTC
GSTT1 reverse primer TCACCGGATCATGGCCAGCA
β-globin forward primer GAAGAGCCAAGGACAGGTAC
β-globin reverse primer CAACTTCATCCACGTTCACC

GST = glutathione-S-transferase; PCR = polymerase chain re-action; GSTM1 = glutathione-S-transferase mu 1; GSTT1 = glu hione-S-transferase theta 1.

Comparison of clinical characteristics and GST genotypes frequencies between T2DM and control

Characteristics T2DM (n = 236) Control (n = 45) p-value
Age (years) 58.3 ± 10.9 54.2 ± 17.6 0.129
Sex (male/female, n) 133/103 27/18 0.651
Spherical equivalent (D) -0.05 ± 2.02 -0.19 ± 2.1 0.663
GSTT1 (null/present, n) 133/103 16/29 0.010
GSTM1 (null/present, n) 100/136 23/22 0.279
GSTT1-GSTM1 (null-null/except null-null, n) 79/157 10/35 0.137

Values are presented as mean ± SD unless otherwise indicated.

GST = glutathione-S-transferase; T2DM = type 2 diabetes mellitus; GSTT1 = glutathione-S-transferase theta 1; GSTM1 = glutathione-S- transferase mu 1.

Comparison of GST genotypes among 3 populations

T2DM with DR (n = 131) T2DM without DR (n = 105) Normal control (n = 45) Pearson χ2 p-value
GSTT1*
  Null 71 (54.2) 62 (59.0) 16 (35.6) 7.12 0.029
  Present 60 (45.8) 43 (41.0) 29 (64.4)
GSTM1*
  Null 47 (35.9) 53 (50.5) 23 (51.1) 6.22 0.045
  Present 84 (64.1) 52 (49.5) 22 (48.9)
GSTT1-GSTM1*
  Null homo 47 (35.9) 32 (30.5) 10 (22.2) 3.00 0.223
  Hetero, Present Homo 84 (64.1) 73 (69.5) 35 (77.8)

Values are presented as n (%) unless otherwise indicated.

GST = glutathione-S-transferase; T2DM = type 2 diabetes mellitus; DR = diabetic retinopathy; χ2 = chi square; GSTT1 = glutathione- S-transferase theta 1; GSTM1 = glutathione-S-transferase mu 1; Null homo = GSTT1/GSTM1 (null/null); Hetero = GSTT1/ GSTM1(null/present) or (present/null); Present Homo = GSTT1/GSTM1(present/present).

Chi-square test; p < 0.05 is considered statistically significant.

Comparison of clinical characteristics and GST genotypes frequencies between two studied groups

Characteristics T2DM with DR (n = 131) T2DM without DR (n = 105) OR (95% CI) p-value
Age* (years) 57.6 ± 10.5 59.3 ± 11.4 0.222
Sex† (male/female, n [%]) 72/59 (55/45) 61/44 (58/42) 1.14 (0.68-1.91) 0.630
Spherical equivalent* (D) 0.02 ± 2.2 -0.14 ± 1.8 0.542
DM duration* (years) 14.9 ± 8.3 11.9 ± 1.8 0.004
Insulin therapy† (yes/no, n [%]) 62/69 (47/53) 49/56 (47/53) 1.03 (0.61-1.72) 0.512
HTN† (yes/no, n [%]) 67/64 (51/49) 57/48 (54/46) 0.88 (0.53-1.48) 0.364
Dylipidemia† (yes/no, n [%]) 6/125 (5/95) 7/98 (7/93) 0.67 (0.22-2.06) 0.338
CVA history† (yes/no, n [%]) 12/119 (11/89) 13/92 (12/88) 1.14 (0.48-2.67) 0.549
CHD history† (yes/no, n [%]) 13/118 (11/89) 10/95 (10/90) 0.37 (0.17-1.04) 0.085
Smoking† (yes/no, n [%]) 29/111 (22/78) 25/80 (24/76) 0.55 (0.31-1.17) 0.487
HbA1c* (%) 8.3 ± 2.1 7.6 ± 1.7 0.004
Height* (cm) 163.6 ± 8.7 162.3 ± 7.6 0.239
Weight* (kg) 67.4 ± 14.9 65.7 ± 10.4 0.324
BMI* (kg/m2) 25.2 ± 5.7 24.9 ± 3.5 0.626
GSTT1† (null/present, n [%]) 71/60 (54/46) 62/43 (59/41) 0.82 (0.49-1.38) 0.270
GSTM1† (null/present, n [%]) 47/84 (36/64) 53/52 (51/49) 0.55 (0.33-0.93) 0.017
GSTT1-GSTM1† (null-null/except 47/84 (36/64) 32/73 (31/69) 1.28 (0.74-2.21) 0.231
null-null, n [%])

Values are presented as mean ± SD or n (%) unless otherwise indicated.

GST = glutathione-S-transferase; T2DM = type 2 diabetes mellitus; DR = diabetic retinopathy; OR = odds ratio; CI = confidence interval; DM = diabetes mellitus; HTN = hypertension; CVA = cerebrovascular accident; CHD = carotid artery disease; HbA1c = hemoglobin A1c; BMI = body mass index; GSTT1 = glutathione-S-transferase theta 1; GSTM1 = glutathione-S-transferase mu 1.

Student t-test: p < 0.05 is considered statistically significant;

Chi-square test: p < 0.05 is considered statistically significant.

Comparison of GST genotypes according to severity of diabetic retinopathy (n = 131)

Moderate NDPR (n = 14) Severe NPDR (n = 9) PDR (n = 108) Pearson χ2 p-value
GSTT1*
  Null 6 (4.4) 4 (3.1) 47 (36.0) 0.11 0.946
  Present 8 (5.9) 5 (3.8) 61 (46.8)
GSTM1*
  Null 11 (8.1) 7 (5.4) 65 (49.8) 2.24 0.326
  Present 3 (2.2) 2 (1.5) 43 (33.0)
GSTT1-GSTM1*
  Null homo 11 (8.1) 7 (5.4) 65 (49.8) 2.24 0.326
  Hetero, Present Homo 3 (2.2) 2 (1.5) 43 (33.0)

Values are presented as n (%) unless otherwise indicated.

GST = glutathione-S-transferase; NPDR = non-proliferative diabetic retinopathy; PDR = proliferative diabetic retinopathy; χ2 = chi square GSTT1 = glutathione-S-transferase theta 1; GSTM1 = glutathione-S-transferase mu 1; Null homo = GSTT1/GSTM1 (null/null); Hetero = GSTT1/GSTM1 (null/present) or (present/null); Present Homo = GSTT1/GSTM1(present/present).

Chi-square test: p < 0.05 is considered statistically significant.

Risk factors for diabetic retinopathy in patients with T2DM

Risk factors OR 95% CI p-value
GSTM1-null 0.50 0.31-0.69 0.013*
T2DM duration 1.05 1.02-1.08 0.007*
HbA1c 1.20 1.13-1.27 0.012*

Mulitivariate logistic regression analysis.

T2DM = type 2 diabetes mellitus; OR = odds ratio; CI = con-fidence interval; GSTM1 = glutathione-S-transferase mu 1; HbA1c = hemoglobin A1c.

p < 0.05 is considered statistically significant.