Journal List > J Bacteriol Virol > v.38(4) > 1033903

TOOLS
Kwon, Cha, Choi, Kim, Song, and Jang: Epidemiological Prevalence of Avian Pathogenic Escherichia coli Differentiated by Multiplex PCR from Commercial Chickens and Hatchery in Korea
Original Article

J Bacteriol Virol 2008;38(4):179-188.

Published online: 18 January 2008

DOI: https://doi.org/10.4167/jbv.2008.38.4.179

Epidemiological Prevalence of Avian Pathogenic Escherichia coli Differentiated by Multiplex PCR from Commercial Chickens and Hatchery in Korea

Soon-Gu Kwon1, Se-Yeoun Cha1, Eun-Ju Choi1, Bokyung Kim2, Hee-Jong Song1, Hyung-Kwan Jang1

1Department of Infectious Diseases and Avian Diseases, College of Veterinary Medicine and Bio-Safety Research Institute, Chonbuk National University, Jeonju 561-756, Republic of Korea

2Department of Physiology, College of Medicine and Bio-Food and Drug Research Center, Konkuk University, Chungju 380-701, Republic of Korea

∗Corresponding author: Hyung-Kwan Jang. Department of Infectious Diseases and Avian Diseases, College of Veterinary Medicine and Bio-Safety Research Institute, Chonbuk National University, Jeonju 561-756, Republic of Korea. Phone: +82-63-270-3885, Fax: +82-63-270-2135 e-mail: hkjang@chonbuk.ac.kr

      Revised 16 July 20088 October 2008       Accepted 9 October 2008

Copyright © 2008 Korean Society for Legal Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

We examined 216 Escherichia coli (E. coli) isolated from chickens and environmental specimens from hatcheries between 2005 and 2006 in order to evaluate the epidemiological prevalence of avian pathogenic E. coli (APEC) in Korea tentatively by multiplex PCR. The multiplex PCR which was used as tentative criteria of APEC targets 8 virulence-associated genes; enteroaggregative toxin (astA), increased serum survival protein (iss), iron-repressible protein (irp2), P fimbriae (papC), aerobactin (iucD), temperature-sensitive hemagglutinin (tsh), vacuolating autotransporter toxin (vat), and colicin V plasmid operon (cva/cvi) genes. The number of detected genes could be used as a reliable index of their virulence. It was demonstrated that E. coli strains already typed as APEC always harbor 5 to 8 genes, but non-APEC strains harbor less than 4 genes. Assuming the criteria of APEC is a possession of more than 5 virulence-associated genes, we discriminated 24 APEC strains among the 216 E. coli strains. Contamination rates of APEC in the field were 31.3% in layers, 14.0% in broilers, 2.7% in broiler breeders, and 0.0% in environmental specimens from hatcheries. The combinational tendency of APEC examined is a fundamental possession of astA, iss and iucD genes and addition of cva/cvi, tsh, vat, and irp2 genes which have a critical importance for virulent traits of APEC. Compared with intravenous chicken challenge or embryo lethality assay, multiplex PCR method could be useful to discriminate APEC rapidly for convenient diagnosis.

Keywords: Avian pathogenic E. coli, Multiplex PCR

REFERENCES

1). Amabile de Campos T., Stehling EG., Ferreira A., Pestana de Castro AF., Brocchi M., Dias da Silveira W. Adhesion properties, fimbrial expression and PCR detection of adhesin-related genes of avian Escherichia coli strains. Vet Microbiol. 106:275–285. 2005.
2). Barnes HJ., Nolan LK., Vaillancourt JP. Colibacillosis. pp.p. 691–732. In. Diseases of Poultry. 12th ed. Saif YM, Fadly AM, Glisson JR, McDougald LR, Nolan LK, Swayne DE, editors. (Ed.),. Blackwell Pub. Professional, Ames, Iowa;2008.
3). Dozois CM., Dho-Moulin M., Brée A., Fairbrother JM., Desautels C., Curtiss R 3rd. Relationship between the tsh autotransporter and pathogenicity of avian Escherichia coli and localization and analysis of tsh genetic region. Infect Immun. 68:4145–4154. 2000.
4). Dozois CM., Fairbrother JM., Harel J., Bossé M. pap- and pil-related DNA sequences and other virulence determinants associated with Escherichia coli isolated from septicemic chickens and turkeys. Infect Immun. 60:2648–2656. 1992.
5). Ellis MG., Arp LH., Lamont SJ. Serum resistance and virulence of Escherichia coli isolated from turkeys. Am J Vet Res. 49:2034–2037. 1988.
6). Ewers C., Janssen T., Kiessling S., Philipp HC., Wieler LH. Rapid detection of virulence-associated genes in avian pathogenic Escherichia coli by multiplex polymerase chain reaction. Avian Dis. 49:269–273. 2005.
7). Gibbs PS., Maurer JJ., Nolan LK., Wooley RE. Prediction of chicken embryo lethality with the avian Escherichia coli traits complement resistance, colicin V production, and presence of the increased serum survival gene cluster (iss). Avian Dis. 47:370–379. 2003.
8). Gibbs PS., Wooley RE. Comparison of the intravenous chicken challenge method with the embryo lethality assay for studies in avian colibacillosis. Avian Dis. 47:672–680. 2003.
crossref
9). Gilson L., Mahanty HK., Kolter R. Four plasmid genes are required for colicin V synthesis, export, and immunity. J Bacteriol. 169:2466–2470. 1987.
crossref
10). Gophna U., Oelschlaeger TA., Hacker J., Ron EZ. Yersinia HPI in septicemic Escherichia coli strains isolated from diverse hosts. FEMS Microbiol Lett. 196:57–60. 2001.
11). Henderson IR., Navarro-Garcia F., Desvaux M., Fernandez RC., Ala'Aldeen D. Type V protein secretion pathway: the autotransporter story. Microbiol Mol Biol Rev. 68:692–744. 2004.
crossref
12). Janben T., Schwarz C., Preikschat P., Voss M., Philipp HC., Wieler LH. Virulence-associated genes in avian pathogenic Escherichia coli (APEC) isolated from internal organs of poultry having died from colibacillosis. Int J Med Microbiol. 291:371–378. 2001.
13). Johnson TJ., Siek KE., Johnson SJ., Nolan LK. DNA sequence of a ColV plasmid and prevalence of selected plasmid-encoded virulence genes among avian Escherichia coli strains. J Bacteriol. 188:745–758. 2006.
14). Kostakioti M., Stathopoulos C. Functional analysis of tsh autotransporter from an avian pathogenic Escherichia coli strain. Infect Immun. 72:5548–5554. 2004.
15). Ménard LP., Dubreuil JD. Enteroaggregative Escherichia coli heat-stable enterotoxin 1 (EAST1): a new toxin with an old twist. Crit Rev Microbiol. 28:43–60. 2002.
16). Morris M. Poultry health issue. Poultry Times July. 3:11. 1989.
17). Paiva de Sousa C., Dubreuil JD. Distribution and expression of the astA gene (EAST1 toxin) in Escherichia coli and Salmonella. Int J Med Microbiol. 291:15–20. 2001.
18). Parreira VR., Gyles CL. A novel pathogenicity island integrated adjacent to the thrW tRNA gene of avian pathogenic Escherichia coli encodes a vacuolating autotransporter toxin. Infect Immun. 71:5087–5096. 2003.
19). Pfaff-McDonough SJ., Horne SM., Giddings CW., Ebert JO., Doetkott C., Smith MH., Nolan LK. Complement resistance-related traits among Escherichia coli isolates from apparently healthy birds and birds with colibacillosis. Avian Dis. 44:23–33. 2000.
20). Provence DL., Curtiss R 3rd. Isolation and characterization of a gene involved in hemagglutination by an avian pathogenic Escherichia coli strain. Infect Immun. 62:1369–1380. 1994.
21). Rodriguez-Siek KE., Giddings CW., Doetkott C., Johnson TJ., Nolan LK. Characterizing the APEC pathotype. Vet Res. 36:241–256. 2005.
crossref
22). Salvadori MR., Yano T., Carvalho HE., Parreira VR., Gyles CL. Vacuolating cytotoxin produced by avian pathogenic Escherichia coli. Avian Dis. 45:43–51. 2001.
23). Tivendale KA., Allen JL., Ginns CA., Crabb BS., Browning GF. Association of iss and iucA, but not tsh, with plasmid-mediated virulence of avian pathogenic Escherichia coli. Infect Immun. 72:6554–6560. 2004.
24). Valvano MA., Crosa JH. Aerobactin iron transport genes commonly encoded by certain ColV plasmids occur in the chromosome of a human invasive strain of Escherichia coli K1. Infect Immun. 46:159–167. 1984.
25). Vandekerchove D., Vandemaele F., Adriaensen C., Zaleska M., Hernalsteens JP., De Baets L., Butaye P., Van Immerseel F., Wattiau P., Laevens H., Mast J., Goddeeris B., Pasmans F. Virulence-associated traits in avian Escherichia coli: comparison between isolates from colibacillosis-affected and clinically healthy layer flocks. Vet Microbiol. 108:75–87. 2005.
26). Veilleux S., Dubreuil JD. Presence of Escherichia coli carrying the EAST1 toxin gene in farm animals. Vet Res. 37:3–13. 2006.
27). Waters VL., Crosa JH. Colicin V virulence plasmids. Microbiol Rev. 55:437–450. 1991.
crossref
28). Wooley RE., Gibbs PS., Brown TB., Maurer JJ. Chicken embryo lethality assay for determining the virulence of avian Escherichia coli isolates. Avian Dis. 44:318–324. 2000.
29). Yamamoto T., Nakazawa M. Detection and sequences of the enteroaggregative Escherichia coli heat-stable enterotoxin 1 gene in enterotoxigenic E. coli strains isolated from piglets and calves with diarrhea. J Clin Microbiol. 35:223–227. 1997.

Figure 1.
Amplicon patterns of virulence-associated genes by multiplex PCR. (A) Combinations of virulence-associated genes of APEC differentiated by multiplex PCR. There were 14 combinations of virulence-associated genes in 24 APEC strains. M: 100 bp ladder; Lanes 1~2: gene combinations of strains which had 7 virulence-associated genes; Lanes 3~6: gene combinations of strains which had 6 virulence-associated genes; Lanes 7~14: gene combinations of strains which had 5 virulence-associated genes. (B) Combinations of virulence-associated genes of non-APEC differentiated by multiplex PCR. There were 16 combinations of virulence-associated genes which match to more than 2 non-APEC strains. M: 100 bp ladder; Lanes 1~3: main gene combinations of strains which had 4 virulence-associated genes; Lanes 4~8: main gene combinations of strains which had 3 virulence-associated genes; Lanes 9~11: main gene combinations of strains which had 2 virulence-associated genes; Lanes 12~16: main gene combinations of strains which had 1 virulence-associated genes.
jbv-38-179f1.tif
Figure 2.
Total detection rates of virulence-associated genes between APEC and non-APEC. (A) Detection rates of virulence-associated genes in APEC. (B) Detection rates of virulence-associated genes in non-APEC. Taken altogether, virulence-associated genes were more frequently appeared in APEC than non-APEC. Detection rates of irp2, tsh, vat and cva/cvi in APEC were relatively higher than detection rates of the corresponding genes in non-APEC, respectively. On the other hand, detection rates of astA, iss and iucD were quite high in non-APEC as well as APEC strains. In addition, detection rate of papC was very low in both APEC and non-APEC.
jbv-38-179f2.tif
Table 1.
Sequence and specificity of PCR primers and their product sizes
No Virulent genes Primer sequence (5′ - 3′) Location within gene GenBank Acc. No Size (bp)
1 astA TGCCATCAACACAGTATATCC TCAGGTCGCGAGTGACGGC 797~817 912~894 AF143819 116
2 iss ATCACATAGGATTCTGCCG CAGCGGAGTATAGATGCCA (–)10~(–)28 282~264 X52665 309
3 irp2 AAGGATTCGCTGTTACCGGAC AACTCCTGATACAGGTGGC 22~42 434~416 L18881 413
4 papC TGATATCACGCAGTCAGTAGC CCGGCCATATTCACATAA 1284~1304 1784~1767 Y00529 501
5 iucD ACAAAAAGTTCTATCGCTTCC CCTGATCCAGATGATGCTC 239~259 952~934 M18968 714
6 tsh ACTATTCTCTGCAGGAAGTC CTTCCGATGTTCTGAACGT 132~151 955~937 AF218073 824
7 vat TCCTGGGACATAATGGTCAG GTGTCAGAACGGAATTGT 1076~1095 2056~2038 AY151282 981
8 cva A/B cvi cvaC TGGTAGAATGTGCCAGAGCAAG GAGCTGTTTGTAGCGAAGCC 10745~10764 11925~11904 AJ223631 1,181
Table 2.
Detection rates of APEC from the field isolates of E. coli
Origin Total isolates APEC Detection rates (%)
Layer 16 5 31.3
Broiler breeder 37 1 2.7
Broiler 129 18 14.0
Hatchery 34 0 0.0
Total 216 24 11.1
Table 3.
Detection rates of virulence-associated genes amomg 216-field isolates of Escherichia coli
Detection rates of virulence-associated genes (%)
Virulence-associated genes Origins of Escherichia coli
Layer Broiler breeder Broiler Hatchery
APEC Non-APEC APEC Non-APEC APEC Non-APEC APEC Non-APEC
astA 0/5 (0) 3/11 (27) 0/1 (0) 14/36 (39) 10/18 (56) 23/111 (21) 0/0 (0) 3/34 (8.8)
iss 5/5 (100) 9/11 (82) 1/1 (100) 13/36 (36) 18/18 (100) 62/111 (56) 0/0 (0) 5/34 (15)
irp2 4/5 (80) 4/11 (36) 1/1 (100) 9/36 (25) 12/18 (67) 9/111 (8.1) 0/0 (0) 3/34 (8.8)
papC 0/5 (0) 0/11 (0) 0/1 (0) 0/36 (0) 2/18 (11) 1/111 (0.9) 0/0 (0) 2/34 (5.9)
iucD 5/5 (100) 6/11 (55) 1/1 (100) 19/36 (53) 15/18 (83) 52/111 (47) 0/0 (0) 0/34 (0)
tsh 5/5 (100) 1/11 (9) 0/1 (0) 2/36 (5.6) 17/18 (94) 4/111 (3.6) 0/0 (0) 0/34 (0)
vat 5/5 (100) 2/11 (18) 1/1 (100) 0/36 (0) 16/18 (89) 5/111 (4.5) 0/0 (0) 0/34 (0)
cva/cvi 2/5 (40) 1/11 (9) 1/1 (100) 1/36 (2.7) 16/18 (89) 7/111 (6.3) 0/0 (0) 0/34 (0)
Table 4.
Combinations of virulence-associated genes in 24 isolates of APEC
No Origin Strain astA iss irp2 papC iucD tsh vat cva/cvi
1 Layer L/06/2   + +   + + +  
2 Layer L/06/3   + +   + + +  
3 Layer L/06/4   +     + + + +
4 Layer L/06/8   + +   + + + +
5 Layer L/06/14   + +   + + +  
6 BBa PS/06/1   + +   +   + +
7 Broiler B/06/6   + +   + + + +
8 Broiler B/06/7   + +   + + + +
9 Broiler B/06/13 + +     +   + +
10 Broiler B/06/16   + +   + + + +
11 Broiler B/06/17   + +   + + + +
12 Broiler B/06/19 + +     + + + +
13 Broiler B/06/21   + +   + + + +
14 Broiler B/06/25 + + +   + + +  
15 Broiler B/06/31 + + +   + + + +
16 Broiler B/06/34 + +   + + + + +
17 Broiler B/06/63 + +     + + + +
18 Broiler B/06/77 + + +   + + + +
19 Broiler B/06/78   + +   + + + +
20 Broiler B/06/79   + +     + + +
21 Broiler B/06/80 + +       + + +
22 Broiler HC/06/1   + +   + +   +
23 Broiler HC/06/8 + +   + + +   +
24 Broiler HC/06/9 + + +     + +  

a Broiler breeder

TOOLS
Similar articles