ADSCs were isolated from subcutaneous abdominal adipose tissue obtained from three male donors (mean age, 40 years) during plastic surgery. Body mass indices of the donors were 22.6, 26, and 23.6 kg/m². They had received no medications, including antilipidemic or antidiabetic agents. The donors provided written informed consent, and the study protocol was approved by the Institutional Review Board of Pusan National University Hospital (IRB number 2013-8).

Knife biopsies of adipose tissue were immediately placed in minimum essential medium-alpha (MEM α, Life Technologies, Carlsbad, CA, USA) supplemented with 100 U/mL penicillin and 100 µg/mL streptomycin (Life Technologies). Samples were transported to the laboratory and processed within 30 minutes of excision. Using a sterile technique, the tissue was finely minced and digested with 0.075% type I collagenase (Sigma-Aldrich, St. Louis, MO, USA) for 30 minutes at 37℃, with vigorous shaking. Then, 25 mL of MEM α containing 10% fetal bovine serum (FBS) were added to neutralize the collagenase, and the suspension was centrifuged at 3,000 rpm for 10 minutes. Next, samples were filtered through a 70µm nylon cell strainer (BD Biosciences, San Diego, CA, USA), washed with phosphate-buffered saline (PBS), and centrifuged at 1,600 rpm for 10 minutes. The isolated ADSCs were maintained and expanded in ADSC culture medium consisting of MEM α containing 10% FBS, 100 U/mL penicillin, and 100 µg/mL streptomycin at 37℃ in 5% CO₂. This initial culture was referred to as passage zero. The medium was replaced twice per week. When the monolayer of adherent cells reached 80% to 90% confluence, cells were trypsinized using 0.25% trypsin-EDTA (Life Technologies) and subcultured to passage three.

Flow cytometry was used to characterize the surface marker expression of passage three ADSCs. Briefly, the medium was aspirated and the cell layer was washed with PBS before incubation with 1-mL 0.25% trypsin-EDTA for 3 minutes. Monoclonal antibodies against CD90, CD44, CD73, CD105, CD31, CD19, CD11b, and HLA-DR were used (all from BD Biosciences). Cells were analyzed using a FACSAria flow cytometer (BD Biosciences). Analysis was performed on 10,000 cells per sample and unstained cell samples were used to compensate for background autofluorescence levels.

For osteogenic induction, ADSCs were seeded on six-well plates at 3×10⁵ cells/well. Next, the medium was replaced with osteogenic medium consisting of MEM α supplemented with 10% FBS, 100 U/mL penicillin, 100 µg/mL streptomycin, L-glutamine, 0.1 µM dexamethasone, 50 µM ascorbate-2-phosphate, and 10 mM β-glycerophosphate (Sigma-Aldrich). The medium was changed twice weekly.

On day 21 of osteogenic induction, the medium was removed and cells were washed with PBS. Cells were fixed with 70% iced ethanol for 15 minutes at 4℃ and washed with distilled water. Alizarin red S staining solution was prepared by dissolving 1 g of Alizarin red S (Sigma-Aldrich) in 100 mL of distilled water, mixing, and adjusting the pH to 4.12 with 0.1% NH₄OH. Images of Alizarin red S-stained cells were captured with a DS-U2 digital sight camera (Nikon, Tokyo, Japan).

Total RNA was extracted using TRIzol reagent (Life Technologies) according to the manufacturer's instructions. Each sample, containing 2 µg of RNA, was heated at 65℃ for 15 minutes, before addition of reverse transcriptase. cDNA was prepared through incubation at 50℃ for 60 minutes using the DiaStar RT Kit (SolGent, Seoul, Korea), and real-time polymerase chain reaction (PCR) was performed using a LightCycler instrument (Roche Applied Science, Indianapolis, IN, USA). LightCycler DNA Master SYBR-Green I (Roche Applied Science), cDNA template, primer pairs, and 25 mM MgCl₂ were added to microcapillary tubes to give a final volume of 20 µL. PCR was conducted for 40 to 50 cycles, each consisting of predenaturation at 95℃ for 10 seconds, 5 seconds at a specific annealing temperature, and primer extension at 72℃ for 20 seconds. The expression level of the target gene was normalized to the β-actin expression level. Melting curves were visually inspected to confirm the specificity of product detection. The primer sequences were as follows: GLP-1r, TCAAGGTCAACGGCTTATTAG (forward) and TAACGTGTCCCTAGATGAACC (reverse); osteocalcin (OC), AGCAAAGGTGCAGCCTTTGT (forward) and GCGCCTGGGTCTCTTCACT (reverse); and alkaline phosphatase (ALP), CCCCCGTGGCAACTCTATCT (forward) and GATGGCAGTGAAGGGCTTCTT (reverse).

Cells were isolated using PRO-PREPTM Protein Extraction Solution (iNtRON Biotechnology, Seoul, Korea). Protein concentrations were determined using the BCA protein assay kit (iNtRON). GLP-1R protein was separated by 10% SDS-PAGE and electroblotted onto a Hybond-ECL nitrocellulose membrane (Amersham Biosciences, Little Chalfont, UK). The membrane was blocked with 5% skim milk and incubated with GLP-1R antibody (1:1,000 dilution; Abcam, Cambridge, UK), and subsequently with horseradish peroxidase-conjugated rabbit anti-mouse IgG (Cell Signaling Technology, Danvers, MA, USA). Immunoreactive bands were detected using the West-One Western Blot Detection System (iNtRON).

All statistical analyses were performed using SPSS version 17.0 (SPSS Inc., Chicago, IL, USA). For all variables, descriptive statistics, including the mean and standard deviation, were determined for each day. Relative GLP-1R gene expression levels were compared by repeated measures one-way analysis of variance to test for time-dependency. P<0.05 was considered to indicate statistical significance.

ADSCs exhibited fibroblast-like morphology and adhered to plastic (Fig. 1A). To confirm their multipotent differentiation potential, specific surface antigen expression was assessed according to the minimal criteria established by the International Society for Cellular Therapy [12]. The cells showed positive expression (≥95%) of mesenchymal stem cell (MSC)-specific antigen markers, including CD90, CD73, and CD105. Conversely, expression of CD11b (a hematopoietic cell marker prominently expressed on monocytes and macrophages), CD19 (a B cell marker), CD31 (a hematopoietic cell marker expressed on the surfaces of platelets, monocytes, and neutrophils), CD34 (a marker for primitive hematopoietic progenitors and endothelial cells), and HLA-DR was not detected (Fig. 1B).

Osteogenic differentiation was confirmed by cytochemical staining and gene expression analysis. After 21 days of osteogenic induction, positive Alizarin red S staining consistent with matrix calcification was observed (Fig. 2A). ALP is a commonly used marker for early osteogenic differentiation. In our study, ALP was notably upregulated at the 21 days (Fig. 2B). Expression of the late osteogenic marker OC is known to be upregulated immediately prior to mineralization, and we observed significant increases in OC mRNA levels by day 21 of differentiation (Fig. 2C).

Up-regulation of GLP1-R protein expression during the osteoblastic developmental sequence was confirmed by Western blot data for day 21 (Fig. 3A). Real-time PCR was used to assess the time-course of GLP-1R mRNA expression during osteogenic differentiation. For each time-point (0, 7, 14, and 21 days), the GLP-1R mRNA level of each sample was normalized to that of β-actin. The mean GLP-1R activity of ADSCs increased significantly in a time-dependent manner that was related to the degree of differentiation (P=0.013) (Fig. 3B).