Journal List > Korean J Lab Med > v.30(6) > 1011702

TOOLS
Li, Jang, Bae, Park, Kim, Shin, Moon, and Park: Frequency of Extended-spectrum β-lactamase (ESBL) and AmpC β-lactamase Genes in Escherichia coli and Klebsiella pneumoniae over a Three-year Period in a University Hospital in Korea
Original Article

Korean J Leg Med 2010;30(6):616-623.

Published online: 14 January 2010

DOI: https://doi.org/10.3343/kjlm.2010.30.6.616

Frequency of Extended-spectrum β-lactamase (ESBL) and AmpC β-lactamase Genes in Escherichia coli and Klebsiella pneumoniae over a Three-year Period in a University Hospital in Korea

Xue Min Li, M.D.1, Sook-Jin Jang, M.D.1, 2, Il Kwon Bae, Ph.D3, Geon Park, M.D.2, Young Sook Kim, M.D.4, Jong Hee Shin, M.D.5, Dae Soo Moon, M.D.2, Young Jin Park, M.D.2

1Research Center for Resistant Cells, Korea

2Department of Laboratory Medicine, Chosun University College of Medicine, Gwangju, Korea

3Department of Laboratory Medicine and Research Institute of Bacterial Resistance, Yonsei University College of Medicine, Seoul, Korea

4Department of Radiology, Chosun University College of Medicine, Gwangju, Korea

5Department of Laboratory Medicine, Chonnam National University College of Medicine, Gwangju, Korea

Corresponding author: Sook-Jin Jang, M.D. Department of Laboratory Medicine, Chosun University College of Medicine, 588 Seoseok-dong, Dong-gu, Gwangju 501-717, Korea Tel: +82-62-220-3272, Fax: +82-62-232-2063 E-mail: sjbjang@chosun.ac.kr

∗ This study was supported by a grant from the Clinical Medicine Research Institute at Chosun University Hospital (2006).

      Revised 31 March 20106 September 2010       Accepted 14 October 2010

Copyright © 2010 Korean Society for Legal Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background:

The aim of this study was to determine the yearly prevalence and genotype distribution of extended-spectrum β-lactamase (ESBL)-producing Escherichia coli and Klebsiella pneumoniae collected over a 3-yr period in Gwangju, Korea.

Methods:

Clinical isolates of E. coli and K. pneumoniae collected at Chosun University Hospital from September 15, 2005 to September 14, 2008 were evaluated. Antimicrobial susceptibility testing was performed using the Vitek II system (bioMérieux, USA) and agar dilution methods. Screening for ESBL and AmpC β-lactamase genes was performed using PCR amplification of plasmid DNA followed by direct sequencing of the PCR products.

Results:

The percentage of ESBL-producing isolates was 12.6% (196/1,550) for E. coli and 26.2% (294/1,121) for K. pneumoniae. The ESBL gene sequencing results showed that the most prevalent ESBL types were CTX-M (93.5%) and SHV (12.9%) in E. coli, and SHV (73.2%) and CTX-M (46.3%) in K. pneumoniae. The most common ESBL in E. coli was CTX-M-15-like, followed by CTX-M-14-like, SHV-2a-like, and SHV-12-like. The most prevalent ESBL type in K. pneumoniae was SHV-12, followed by CTX-M-14-like and CTX-M-15-like. Fifty-one percent (21/41) of ESBL-producing K. pneumoniae with ESBL types verified by sequencing also had DHA-1-like AmpC β-lactamases. However, none of the ESBL-producing E. coli was positive in the AmpC β-lactamase PCR analysis.

Conclusions:

In this study, the most common types of class A ESBLs identified were CTX-M-15-like in E. coli and SHV-12-like in K. pneumoniae. (Korean J Lab Med 2010;30:616-23)

Keywords: β-lactamase, Prevalence, Escherichia coli, Klebsiella pneumonia

REFERENCES

1.Yum JH., Kim S., Lee H., Yong D., Lee K., Cho SN, et al. Emergence and wide dissemination of CTX-M-type ESBLs, and CMY-2- and DHA-1-type AmpC β-lactamases in Korean respiratory isolates of Klebsiella pneumoniae. J Korean Med Sci. 2005. 20:961–5.
2.Song W., Lee KM., Kim HS., Kim JS., Kim J., Jeong SH, et al. Clonal spread of both oxyimino-cephalosporin- and cefoxitin-resistant Klebsiella pneumoniae isolates co-producing SHV-2a and DHA-1 β-lactamase at a burns intensive care unit. Int J Antimicrob Agents. 2006. 28:520–4.
3.National Committee for Clinical Laboratory Standards. Performance standards for antimicrobial susceptibility testing. Twelfth informational supplement, M100-S12. Wayne, PA: National Committee for Clinical Laboratory Standards;2002.
4.Jeong SH., Bae IK., Kwon SB., Lee JH., Jung HI., Song JS, et al. Investigation of extended-spectrum β-lactamases produced by clinical isolates of Klebsiella pneumoniae and Escherichia coli in Korea. Lett Appl Microbiol. 2004. 39:41–7.
5.Saladin M., Cao VT., Lambert T., Donay JL., Herrmann JL., Ould-Hocine Z, et al. Diversity of CTX-M β-lactamases and their promoter regions from Enterobacteriaceae isolated in three Parisian hospitals. FEMS Microbiol Lett. 2002. 209:161–8.
crossref
6.Jeong SH., Bae IK., Kwon SB., Lee JH., Song JS., Jung HI, et al. Dissemination of transferable CTX-M-type extended-spectrum β-lactamase-producing Escherichia coli in Korea. J Appl Microbiol. 2005. 98:921–7.
7.Machado E., Cantón R., Baquero F., Galán JC., Rollán A., Peixe L, et al. Integron content of extended-spectrum-β-lactamase-producing Escherichia coli strains over 12 years in a single hospital in Madrid, Spain. Antimicrob Agents Chemother. 2005. 49:1823–9.
8.Ryoo NH., Kim EC., Hong SG., Park YJ., Lee K., Bae IK, et al. Dissemination of SHV-12 and CTX-M-type extended-spectrum β-lactamases among clinical isolates of Escherichia coli and Klebsiella pneumoniae and emergence of GES-3 in Korea. J Antimicrob Chemother. 2005. 56:698–702.
9.Pérez-Pérez FJ., Hanson ND. Detection of plasmid-mediated AmpC β-actamase genes in clinical isolates by using multiplex PCR. J Clin Microbiol. 2002. 40:2153–62.
10.Ko KS., Lee MY., Song JH., Lee H., Jung DS., Jung SI, et al. Prevalence and characterization of extended-spectrum β-lactamase-producing Enterobacteriaceae isolated in Korean hospitals. Diagn Microbiol Infect Dis. 2008. 61:453–9.
crossref
11.Song W., Lee H., Lee K., Jeong SH., Bae IK., Kim JS, et al. CTX-M-14 and CTX-M-15 enzymes are the dominant type of extended-spectrum β-lactamase in clinical isolates of Escherichia coli from Korea. J Med Microbiol. 2009. 58:261–6.
12.Kim J., Lim YM., Rheem I., Lee Y., Lee JC., Seol SY, et al. CTX-M and SHV-12 β-lactamases are the most common extended-spectrum enzymes in clinical isolates of Escherichia coli and Klebsiella pneumoniae collected from 3 university hospitals within Korea. FEMS Microbiol Lett. 2005. 245:93–8.
13.Jeong SH., Bae IK., Lee JH., Sohn SG., Kang GH., Jeon GJ, et al. Molecular characterization of extended-spectrum β-lactamases produced by clinical isolates of Klebsiella pneumoniae and Escherichia coli from a Korean nationwide survey. J Clin Microbiol. 2004. 42:2902–6.
14.Park Y., Kang HK., Bae IK., Kim J., Kim JS., Uh Y, et al. Prevalence of the extended-spectrum β-lactamase and qnr genes in clinical isolates of Escherichia coli. Korean J Lab Med. 2009. 29:218–23. (박용정, 강 현경, 배일권, 김주원, 김재석, 어영등. Escherichia coli 의 Extended-Spectrum β-Lactamase 및 qnr 유전자 보유 현황. Korean J Lab Med 2009;29:218-23.).
15.Lee SG., Jeong SH., Lee H., Kim CK., Lee Y., Koh E, et al. Spread of CTX-M-type extended-spectrum β-lactamases among bloodstream isolates of Escherichia coli and Klebsiella pneumoniae from a Korean hospital. Diagn Microbiol Infect Dis. 2009. 63:76–80.
16.Ko CS., Sung JY., Koo SH., Kwon GC., Shin SY., Park JW. Prevalence of extended-spectrum β-lactamases in Escherichia coli and Klebsiella pneumoniae from Daejeon. Korean J Lab Med. 2007. 27:344–50. (고지선,성지연, 구선회, 권계철, 신소연, 박종우. 대전지역에서분리된 Escherichia coli 와 Klebsiella pneumoniae 의생성 Extended-Spectrum β-lactamase 현황 Korean J Lab Med 2007;27:344-50.).
17.Kang JH., Bae IK., Kwon SB., Jeong SH., Lee J., Lee WG, et al. Prevalence of Ambler Class A extended-spectrum β-lactamase-producing Escherichia coli and Klebsiella pneumoniae isolates in Korea. Korean J Clin Microbiol. 2005. 8:17–25. (강지혜, 배일권, 권수봉, 정석훈, 이종욱, 이위교 등. Ambler Class A Extended-Spectrum b-Lactamase 생성 Escherichia coli와 Klebsiella pneumoniae의 국내 분리 현황. 대한임상미생물학회지 2005;8:17-25.).
18.Bae IK., Lee YN., Jeong SH., Lee K., Lee H., Kwak HS, et al. High prevalence of SHV-12 and the emergence of CTX-M-12 in clinical isolates of Klebsiella pneumoniae from Korea. Int J Antimicrob Agents. 2007. 29:362–4.
19.Bae IK., Jeong SH., Lee K., Yong D., Lee J., Hong SG, et al. Emergence of CTX-M-12 and A Novel CTX-M Type Extended-Spectrum β-lactamase producing Klebsiella pneumoniae. Korean J Lab Med. 2006. 26:21–6. (배일권, 정석훈, 이경원, 용동은, 이종욱, 홍성근등. CTX-M-와새로운CTX-M형 Extended-Spectrum β-Lactamase 생성 Klebsiella pneumoniae 의출현.대한진단검사의학회지 2006;26:21-6.).
20.Thomson KS., Cornish NE., Hong SG., Hemrick K., Herdt C., Moland ES. Comparison of Phoenix and VITEK 2 extended-spectrum-β-lactamase detection tests for analysis of Escherichia coli and Klebsiella isolates with well-characterized β-lactamases. J Clin Microbiol. 2007. 45:2380–4.

Table 1.
Primers used for detection and sequencing of ESBL and AmpC β-lactamase by using PCR
Target gene Primer name Primer sequence (5′-3′) Product size (bp) Reference
blaSHV SHV-F GGGTTATTCTTATTTGTCGCT 929 [4]
  SHV-R TAGCGTTGCCAGTGCTCG    
blaCTX-M-1 cluster CTX-1-un-F SCSATGTGCAGYACCAGTAA 543 [5]
  CTX-1-un-R CCGCRATATCRTTGGTGGTG    
blaCTX-M-1 cluster CTX-1-gr-F CCCATGGTTAAAAAATCACTG 891 [6]
  CTX-1-gr-R CCGTTTCCGCTATTACAAAC    
blaCTX-M-9 cluster CTX-M-9-F GTGACAAAGAGAGTGCAACGG 856 [7]
  CTX-M-9-R ATGATTCTCGCCGCTGAAGCC    
blaGES/IBC GES/IBC-F GTTAGACGGGCGTACAAAGATAAT 903 [8]
  GES/IBC-R TGTCCGTGCTCAGGATGAGT    
blaVEB VEB-F ACCAGATAGGAGTACAGACATATGA 727 [8]
  VEB-R TTCATCACCGCGATAAAGCAC    
blaDHA DHA-F AACTTTCACAGGTGTGCTGGGT 405 [9]
  DHA-R CCGTACGCATACTGGCTTTGC    
blaCMY1 CMY-1-F GCTGCTCAAGGAGCACAGGAT 520 [9]
  CMY-1-R CACATTGACATAGGTGTGGTGC    
blaCMY2 CMY-2-F TGGCCAGAACTGACAGGCAAA 462 [9]
  CMY-2-R TTTCTCCTGAACGTGGCTGGC    

Abbreviations: ESBL, extended-spectrum β-lactamase; F, forward; R, reverse.

Table 2.
Rates of ESBL-producing Escherichia coli and Klebsiella pneumoniae isolates
Year E. coli K. pneumoniae
N ESBL-producer N ESBL-producer
(%) N N (%)
2005 106 9 8.5 81 21 25.9
2006 454 60 13.2 281 68 24.2
2007 548 64 11.7 419 101 24.1
2008 442 63 14.3 340 104 30.6
Total 1,550 196 12.6 1,121 294 26.2

Abbreviations: ESBL, extended-spectrum β-lactamase.

Table 3.
Distribution of ESBL-producing Escherichia coli and Klebsiella pneumoniae isolates according to specimen type
Specimen E. coli K. pneumoniae P-value
Total ESBL-producer Total ESBL-producer
N (%) N (%)
Urine 782 83 (10.6) 259 79 (30.5) <0.001
Pus 245 42 (17.1) 162 51 (31.5) <0.022
Sputum 63 22 (34.9) 410 108 (26.3) <0.242
Blood 276 13 (4.7) 104 6 (5.8) <0.251
Bile 24 7 (29.2) 22 7 (31.8) <1.000
Bronchial washing 10 3 (30) 51 10 (19.6) <1.000
Other 142 22 (15.5) 89 17 (19.1) <0.512

Abbreviations: ESBL, extended-spectrum β-lactamase.

Table 4.
Plasmid-mediated AmpC β-lactamases in ESBL-producing Escherichia coli and Klebsiella pneumoniae isolates
Organism ESBL type N (%) Isolates with AmpC β-lactamase (N)
None DHA-1 CMY-1 CMY-2
E. coli CTX-M-14-like 4 (12.9) 4 0 0 0
  CTX-M-15-like 11 (35.5) 11 0 0 0
  CTX-M-14-variant 3 (9.7) 3 0 0 0
  CTX-M-15-variant 9 (29.0) 9 0 0 0
  CTX-M-14-variant + SHV-2a-like 1 (3.2) 1 0 0 0
  CTX-M-15-like + SHV-12-like 1 (3.2) 1 0 0 0
  CTX-M-15-like + SHV-2a-variant 1 (3.2) 1 0 0 0
  SHV-2a-like 1 (3.2) 1 0 0 0
  Total 31 (100) 31 0 0 0
K. pneumoniae CTX-M-14-like 7 (17.1) 5 2 0 0
  CTX-M-15-like 1 (2.4) 0 1 0 0
  CTX-M-14-variant 3 (7.3) 3 0 0 0
  SHV-12-like 19 (46.3) 8 11 0 0
  SHV-12-variant 3 (7.3) 2 1 0 0
  CTX-M-14-like + SHV-12-like 2 (4.9) 1 1 0 0
  CTX-M-15-like + SHV-12-like 1 (2.4) 0 1 0 0
  CTX-M-14-like + SHV-12-variant 1 (2.4) 0 1 0 0
  CTX-M-15-like + SHV-12-variant 2 (4.9) 1 1 0 0
  SHV-12-like + CTX-M-14-variant 2 (4.9) 0 2 0 0
  Total 41 (100) 20 21 0 0

Abbreviations: ESBL, extended-spectrum β-lactamase.

Table 5.
MICs (μg·mL-1) for ESBL-producing Escherichia coli and Klebsiella pneumoniae isolates according to ESBL genotype
Organism ESBL type N Ceftazidime Cefotaxime Cefoxitin
Range MIC50 MIC90 Range MIC50 MIC90 Range MIC50 MIC90
E. coli CTX-M-14-like (3) 7 ≤1-4 ≤1 4 ≥256-≥256 ≥256 ≥256 ≤4-≥256 16 32
  CTX-M-15-like (4) SHV-2a-like 20 1 ≤1-≥256 ≤1 256 256 ≤1-≥256 ≤1 ≥256 ≥256 ≤4-64 4 16 32
  SHV-12-like + CTX-M-15-like 1 256     ≥256     32    
  SHV-2a-like + CTX-M-15-like 1 256     ≥256     32    
K. pneumoniae CTX-M-14-like (1) 10 2-≥256 4 ≥256 ≤1-≥256 128 ≥256 ≤4-≥256 ≤4 ≥256
  CTX-M-15-like 1 ≥256     16     256    
  SHV-12-like (3) 22 256-≥256 ≥256 ≥256 ≤1-≥256 8 ≥256 ≤4-≥256 256 ≥256
  CTX-M-14-like (2) + SHV-12-like (1) 5 4-≥256 ≥256 ≥256 4-≥256 ≥256 ≥256 ≤4-≥256 256 ≥256
  CTX-M-15-like + SHV-12-like (2) 3 128-≥256     8-≥256     ≤4-8    

The numbers in parenthesis indicate the number of strains containing variants of each ESBL genotypes.

Abbreviations: ESBL, extended-spectrum β-lactamase; MIC50, minimum inhibitory concentration required to inhibit the growth of 50% of organisms; MIC90, minimum inhibitory concentration required to inhibit the growth of 90% of organisms.

TOOLS
Similar articles