Association of the GSTM1 and GSTT1 Genes with Diabetic Retinopathy in the Korean Population

Yung Hui Kim; Jee Myung Yang; Jae Yong Jang; Yong-Sok Ji

doi:10.3341/jkos.2017.58.3.313

Journal List > J Korean Ophthalmol Soc > v.58(3) > 1010722

Go to TopGo to Top Go to BottomGo to Bottom

TOOLS

Kim, Yang, Jang, and Ji: Association of the GSTM1 and GSTT1 Genes with Diabetic Retinopathy in the Korean Population

Original Article

J Korean Ophthalmol Soc 2017;58(3):313-320.

Published online: 7 September 2017

DOI: https://doi.org/10.3341/jkos.2017.58.3.313

Association of the GSTM1 and GSTT1 Genes with Diabetic Retinopathy in the Korean Population

Yung Hui Kim, MD¹, Jee Myung Yang, MD^1,², Jae Yong Jang, MD¹, Yong-Sok Ji, M D, PhD^1,

Department of Ophthalmology, Chonnam National University Medical School, Gwangju, Korea

Graduate School of Medical Science and Engineering, Korea Advanced Institute of Science and Technology, Daejeon, Korea

Address reprint requests to Yong-Sok Ji, MD, PhD Department of Ophthalmology, Chonnam National University Hospital, #42 Jebong-ro, Dong-gu, Gwangju 61469, Korea Tel: 82-62-220-6742, Fax: 82-62-227-1642 E-mail: redvein@naver.com

Received 17 November 201624 January 2017 Accepted 24 January 2017

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Purpose

To investigate the correlation between Glutathione-S-transferase (GST) genes and diabetic retinopathy (DR) in pa-tients with type 2 diabetes mellitus (DM).

Methods

In this case-control study, 131 patients who were diagnosed with DR, 105 diabetic patients who did not have DR, and 45 nondiabetic controls were examined from January 2013 to November 2015. To analyze deletion of the GSTT1 and GSTM1 genes, polymerase chain reactions of DNA in a buffy coat from peripheral blood were performed via electrophoresis.

Results

There were no statistically significant differences in age, sex, or spherical equivalent between the 236 type 2 diabetic patients and the 45 normal controls ( p > 0.05). In both univariate and multivariate analyses, the duration of type 2 DR was longer ( p = 0.004, p = 0.013), and HbA1c was higher ( p = 0.004, p = 0.007) in the DR group than in the non-DR group. Presence of a GSTM1 deletion is associated with a lower frequency of DR ( p = 0.017, p = 0.012).

Conclusions

Deletion of the GSTT1 gene is not associated with an increased risk of DR, whereas GSTM1 deletion is associated with a lower risk of DR in patients with type 2 DM in the Korean population. Additional studies with larger sample sizes and differ-ent types of GST genes are needed to confirm this study.

Keywords: Deletion, Diabetes mellitus, Glutathione-S-transferase, Retinopathy

References

1. The effect of intensive treatment of diabetes on the development and progression of long-term complications in insulin-dependent diabetes mellitus The Diabetes Control and Complications Trial Research Group. N Engl J Med. 1993; 329:977–86.

2. Intensive blood-glucose control with sulphonylureas or insulin compared with conventional treatment and risk of complications in patients with type 2 diabetes (UKPDS 33). UK Prospective Diabetes Study (UKPDS) Group. Lancet. 1998; 352:837–53.

3. Wei M, Gaskill SP, Haffner SM, Stern MP. Effects of diabetes and level of glycemia on all-cause and cardiovascular mortality. The San Antonio Heart Study. Diabetes Care. 1998; 21:1167–72.

4. Ebara T, Conde K, Kako Y. . Delayed catabolism of apoB-48 lipoproteins due to decreased heparin sulfate proteoglycan pro-duction in diabetic mice. J Clin Invest. 2000; 105:1807–18.

5. Ginsberg HN. Insulin resistance and cardiovascular disease. J Clin Invest. 2000; 106:453–8.

6. Allen RG, Tresini M. Oxidative stress and gene regulation. Free Radic Biol Med. 2000; 28:463–99.

7. Salinas AE, Wong MG. Glutathione S-transferase--a review. Curr Med Chem. 1999; 6:279–309.

8. Datta SK, Kumar V, Pathak R. . Association of glutathione S-transferase M1 and T1 gene polymorphism with oxidative stress in diabetic and nondiabetic chronic kidney disease. Ren Fail. 2010; 32:1189–95.

9. Landi S. Mammalian class theta GST and differential suscepti-bility to carcinogens: a review. Mutat Res. 2000; 463:247–83.

10. Rebbeck TR. Molecular epidemiology of the human glutathione S-transferase genotypes GSTM1 and GSTT1 in cancer susceptibility. Cancer Epidemiol Biomarkers Prev. 1997; 6:733–43.

11. Chen K, Jiang QT, Ma XY. . Associations between genetic polymorphisms of glutathione S-transferase M1 and T1, smoking and susceptibility to colorectal cancer: a case-control study. Zhonghua Zhong Liu Za Zhi. 2004; 26:645–8.

12. White NH, Sun W, Cleary PA. . Prolonged effect of intensive therapy on the risk of retinopathy complications in patients with type 1 diabetes mellitus: 10 years after the diabetes control and complications Trial. Arch Ophthalmol. 2008; 126:1707–15.

13. Bekris LM, Shephard C, Peterson M. . Glutathione-s-trans-ferase M1 and T1 polymorphisms and associations witih type 1 diabetes age-at-onset. Autoimmunity. 2005; 38:567–75.

14. Grading diabetic retinopathy from stereoscopic color fundus pho-tographs--an extension of the modified Airlie House classification. ETDRS report number 10. Early Treatment Diabetic Retinopathy Study Research Group. Ophthalmology. 1991; 98((5 Suppl)):786–806.

15. Clustering of long-term complications in families with diabetes in the diabetes control and complications trial. The Diabetes Control and Complications Trial Research Group. Diabetes. 1997; 46:1829–39.

16. Abhary S, Hewitt AW, Burdon KP, Craig JE. A systemic meta-anal-ysis of genetic association studies for diabetic retinopathy. Diabetes. 2009; 58:2137–47.

17. Huang YC, Lin JM, Lin JH. . Genome-wide association study of diabetic retinopathy in a Taiwanese population. Ophthalmology. 2011; 118:642–8.

18. Grassi MA, Tikhomirov A, Ramalingam S. . Genome-wide meta-analysis for severe diabetic retinopathy. Hum Mol Genet. 2011; 20:2472–81.

19. Hovnik T, Dolzan V, Bratina NU. . Genetic polymorphisms in genes encoding antioxidant enzymes are associated with diabetic retinopathy in type 1 diabetes. Diabetes Care. 2009; 32:2258–62.

20. Cilenšek I, Mankoč S, Petrovič MG, Petrovič D.GSTT1 null geno-types is a risk factor for diabetic retinopathy in Caucasians with type 2 diabetes, whereas GSTM1 null genotype might confer ^protectionagainstretinopathy. Dis Markers. 2012; 32:93–9.

21. Dadbinpour A, Shiekhha MH, Darbouy M, Afkhami-Ardekani M.Investigating GSTT1 and GSTM1 null genotype as the risk factor of diabetes type 2 retinopathy. J Diabetes Metab Disord. 2013; 12:48.

22. Moasser E, Azarpira N, Shirazi B. . Genetic polymorphisms of glutathione-s-transferase M1 and T1 genes with risk of diabetic retinopathy in Iranian population. Iran J Basic Med Sci. 2014; 17:351–6.

23. Doney AS, Lee S, Leese GP. . Increased cardiovascular mor-bidity and mortality in type 2 diabetes is associated with the gluta-thione S transferase theta-null genotype: a Go-DARTS study. Circulation. 2005; 111:2927–34.

24. Sun L, Zhang Y, Xiong Y. GSTM1 and GSTT1 nul genotype and diabetic retinopathy: a meta-analysis. Int J Clin Exp Med. 2015; 8:1677–83.

25. Lewis SJ, Cherry NM, Niven RM. . GSTM1, GSTT1 and GSTP1 polymorphisms and lung cancer risk. Cancer Lett. 2002; 180:165–71.

26. Lin HJ, Probst-Hensch NM, Louie AD. . Glutathione trans-ferase null genotype, broccoli, and lower prevalence of colorectal adenomas. Cancer Epidemiol Biomarkers Prev. 1998; 7:647–52.

27. London SJ, Yuan JM, Chung FL. . Isothiocyanates, glutathione S-transferase M1 and T1 polymorphisms, and lung-cancer risk: a prospective study of men in Shanghai, China. Lancet. 2000; 356:724–9.

28. Yadav DS, Devi TR, Ihsan R. . Polymorhpisms of gluta-thione-S-transferase genes and the risk of aerodigestive tract can-cers in the Northeast Indian population. Genet test Mol Biomarkers. 2010; 14:715–23.

29. Xiao D, Singh SV. Phenethyl isothiocyanate inhibits angiogenesis in vitro and ex vivo. Cancer Res. 2007; 67:2239–46.

30. Medeiros R, Soares R, Vasconcelos A. . Glutathione S-trans-ferase genotype GSTM1 as a predictor of elevated angiogenic phe-notype in patients with early onset breast cancer. Angiogenesis. 2004; 7:53–8.

31. Poulaki V, Qin W, Joussen AM. . Acute intensive insulin ther-apy exacerbates diabetic blood-retinal barrier breakdown via hypo-xia-inducible factor-1alpha and VEGF. J Clin Invest. 2002; 109:805–15.

32. Gubitosk-Klug RA, Talahalli R, Du Y. . 5-Lipoxygenase, but not 12/15-lipoxygenase, contributes to degeneration of retinal ca-pillaries in a mouse model of diabetic retinopathy. Diabetes. 2008; 57:1387–93.

33. Talahalli R, Zarini S, Sheibani NS. . Increased synthesis of leu-kotrienes in the mouse model of diabetic retinopathy. Invest Ophthalmol Vis Sci. 2010; 51:1699–708.

34. Joachim A, Ruttkowski B. Prostaglandin D(2) synthesis in oeso-phagostomum dentatum is mediated by cytosolic glutathione S-transferase. Exp Parasitol. 2011; 127:604–6.

35. Otto-Knapp R, Jurgovsky K, Schierhorn K, Kunkel G.Antioxidative enzymes in human nasal mucosa after exposure to ozone: possible role of GSTM1 deficiency. Inflamm Res. 2003; 52:51–5.

36. MacLeod S, Sinha R, Kadlubar FF, Lang N. Polymorphisms of CYP1A1 and GSTM1 influence the in vivo function of CYP1A2. Mutat Res. 1997; 376:135–42.

37. Jee D, Lee WK, Kang S. Prevalence and risk factors for diabetic retinopathy: the Korean National Health and Nutrition Examination Survey 2008-2011. Invest Ophthalmol Vis Sci. 2013; 54:6827–33.

38. Petrovic MG, Gilensek I, Petrovic D. Manganese superoxide dis-mutase gene polymorphism (V16A) is associated with diabetic ret-inopathy in Slovene (Caucasians) type 2 diabetes patients. Dis Markers. 2008; 24:59–64.

39. Chistiakov DA, Zotova EV. . The 262T>C promoter polymorphism of the catalase gene is associated with dia-betic neuropathy in type 1 diabetic Russian patients. Diabetes Metab. 2006; 32:63–8.

40. Nomiyama T, Tanaka Y, Piao L. . The polymorphism of man-ganese superoxide dismutase is associated with diabetic nephrop-athy in Japanese type 2 diabetic patients. J Hum Genet. 2003; 48:138–41.

41. Kowluru RA, Kowluru V, Xiong Y, Ho YS. Overexpression of mi-tochondrial superoxide dismutase in mice protects the retina from diabetes-induced oxidative stress. Free Radic Biol Med. 2006; 41:1191–6.

Figure 1.

A multiplex polymerase chain reaction (PCR) analysis of GSTM1 and GSTT1 gene polymorphism. GSTT1 and GSTM1 PCR products were analyzed by electrophoresis on a 1.5% agar-ose gel. Lane M is a 60 base-pair DNA ladder (molecular weight marker). Lane 1 GSTT1-present/GSTM1-present, Lane 2 GSTT1- null/GSTM1-present, Lane 3 GSTT1-present/GSTM1- null, Lane 4 GSTT1-null/GSTM1-null sample. GSTT1 = glutathione-S-trans-ferase theta 1; GSTM1 = glutathione-S-transferase mu 1.

Table 1.

Primer sequen ces for GST multiplex PCR

Primer	Sequence
GSTM1 forward primer	GAACTCCCTGAAAAGCTAAAGC
GSTM1 reverse primer	GTTGGGCTCAAATATACGGTGG
GSTT1 forward primer	TTCCTTACTGGTCCTCACATCTC
GSTT1 reverse primer	TCACCGGATCATGGCCAGCA
β-globin forward primer	GAAGAGCCAAGGACAGGTAC
β-globin reverse primer	CAACTTCATCCACGTTCACC

GST = glutathione-S-transferase; PCR = polymerase chain re-action; GSTM1 = glutathione-S-transferase mu 1; GSTT1 = glu hione-S-transferase theta 1.

Table 2.

Comparison of clinical characteristics and GST genotypes frequencies between T2DM and control

Characteristics	T2DM (n = 236)	Control (n = 45)	p-value
Age (years)	58.3 ± 10.9	54.2 ± 17.6	0.129
Sex (male/female, n)	133/103	27/18	0.651
Spherical equivalent (D)	-0.05 ± 2.02	-0.19 ± 2.1	0.663
GSTT1 (null/present, n)	133/103	16/29	0.010
GSTM1 (null/present, n)	100/136	23/22	0.279
GSTT1-GSTM1 (null-null/except null-null, n)	79/157	10/35	0.137

Values are presented as mean ± SD unless otherwise indicated.

GST = glutathione-S-transferase; T2DM = type 2 diabetes mellitus; GSTT1 = glutathione-S-transferase theta 1; GSTM1 = glutathione-S- transferase mu 1.

Table 3.

Comparison of GST genotypes among 3 populations

	T2DM with DR (n = 131)	T2DM without DR (n = 105)	Normal control (n = 45)	Pearson χ²	p-value
GSTT1*
Null	71 (54.2)	62 (59.0)	16 (35.6)	7.12	0.029
Present	60 (45.8)	43 (41.0)	29 (64.4)
GSTM1*
Null	47 (35.9)	53 (50.5)	23 (51.1)	6.22	0.045
Present	84 (64.1)	52 (49.5)	22 (48.9)
GSTT1-GSTM1*
Null homo	47 (35.9)	32 (30.5)	10 (22.2)	3.00	0.223
Hetero, Present Homo	84 (64.1)	73 (69.5)	35 (77.8)

Values are presented as n (%) unless otherwise indicated.

GST = glutathione-S-transferase; T2DM = type 2 diabetes mellitus; DR = diabetic retinopathy; χ² = chi square; GSTT1 = glutathione- S-transferase theta 1; GSTM1 = glutathione-S-transferase mu 1; Null homo = GSTT1/GSTM1 (null/null); Hetero = GSTT1/ GSTM1(null/present) or (present/null); Present Homo = GSTT1/GSTM1(present/present).

^* Chi-square test; p < 0.05 is considered statistically significant.

Table 4.

Comparison of clinical characteristics and GST genotypes frequencies between two studied groups

Characteristics	T2DM with DR (n = 131)	T2DM without DR (n = 105)	OR (95% CI)	p-value
Age* (years)	57.6 ± 10.5	59.3 ± 11.4		0.222
Sex^† (male/female, n [%])	72/59 (55/45)	61/44 (58/42)	1.14 (0.68-1.91)	0.630
Spherical equivalent* (D)	0.02 ± 2.2	-0.14 ± 1.8		0.542
DM duration* (years)	14.9 ± 8.3	11.9 ± 1.8		0.004
Insulin therapy^† (yes/no, n [%])	62/69 (47/53)	49/56 (47/53)	1.03 (0.61-1.72)	0.512
HTN^† (yes/no, n [%])	67/64 (51/49)	57/48 (54/46)	0.88 (0.53-1.48)	0.364
Dylipidemia^† (yes/no, n [%])	6/125 (5/95)	7/98 (7/93)	0.67 (0.22-2.06)	0.338
CVA history^† (yes/no, n [%])	12/119 (11/89)	13/92 (12/88)	1.14 (0.48-2.67)	0.549
CHD history^† (yes/no, n [%])	13/118 (11/89)	10/95 (10/90)	0.37 (0.17-1.04)	0.085
Smoking^† (yes/no, n [%])	29/111 (22/78)	25/80 (24/76)	0.55 (0.31-1.17)	0.487
HbA1c* (%)	8.3 ± 2.1	7.6 ± 1.7		0.004
Height* (cm)	163.6 ± 8.7	162.3 ± 7.6		0.239
Weight* (kg)	67.4 ± 14.9	65.7 ± 10.4		0.324
BMI* (kg/m²)	25.2 ± 5.7	24.9 ± 3.5		0.626
GSTT1^† (null/present, n [%])	71/60 (54/46)	62/43 (59/41)	0.82 (0.49-1.38)	0.270
GSTM1^† (null/present, n [%])	47/84 (36/64)	53/52 (51/49)	0.55 (0.33-0.93)	0.017
GSTT1-GSTM1^† (null-null/except	47/84 (36/64)	32/73 (31/69)	1.28 (0.74-2.21)	0.231
null-null, n [%])

Values are presented as mean ± SD or n (%) unless otherwise indicated.

GST = glutathione-S-transferase; T2DM = type 2 diabetes mellitus; DR = diabetic retinopathy; OR = odds ratio; CI = confidence interval; DM = diabetes mellitus; HTN = hypertension; CVA = cerebrovascular accident; CHD = carotid artery disease; HbA1c = hemoglobin A1c; BMI = body mass index; GSTT1 = glutathione-S-transferase theta 1; GSTM1 = glutathione-S-transferase mu 1.

^* Student t-test: p < 0.05 is considered statistically significant;

^† Chi-square test: p < 0.05 is considered statistically significant.

Table 5.

Comparison of GST genotypes according to severity of diabetic retinopathy (n = 131)

	Moderate NDPR (n = 14)	Severe NPDR (n = 9)	PDR (n = 108)	Pearson χ²	p-value
GSTT1*
Null	6 (4.4)	4 (3.1)	47 (36.0)	0.11	0.946
Present	8 (5.9)	5 (3.8)	61 (46.8)
GSTM1*
Null	11 (8.1)	7 (5.4)	65 (49.8)	2.24	0.326
Present	3 (2.2)	2 (1.5)	43 (33.0)
GSTT1-GSTM1*
Null homo	11 (8.1)	7 (5.4)	65 (49.8)	2.24	0.326
Hetero, Present Homo	3 (2.2)	2 (1.5)	43 (33.0)

Values are presented as n (%) unless otherwise indicated.

GST = glutathione-S-transferase; NPDR = non-proliferative diabetic retinopathy; PDR = proliferative diabetic retinopathy; χ² = chi square GSTT1 = glutathione-S-transferase theta 1; GSTM1 = glutathione-S-transferase mu 1; Null homo = GSTT1/GSTM1 (null/null); Hetero = GSTT1/GSTM1 (null/present) or (present/null); Present Homo = GSTT1/GSTM1(present/present).

^* Chi-square test: p < 0.05 is considered statistically significant.

Table 6.

Risk factors for diabetic retinopathy in patients with T2DM

Risk factors	OR	95% CI	p-value
GSTM1-null	0.50	0.31-0.69	0.013*
T2DM duration	1.05	1.02-1.08	0.007*
HbA1c	1.20	1.13-1.27	0.012*

Mulitivariate logistic regression analysis.

T2DM = type 2 diabetes mellitus; OR = odds ratio; CI = con-fidence interval; GSTM1 = glutathione-S-transferase mu 1; HbA1c = hemoglobin A1c.

^* p < 0.05 is considered statistically significant.

TOOLS

Similar articles